Human RETNLB/FIZZ1/ FIZZ2 ORF/cDNA clone-Lentivirus plasmid (NM_032579)

Pre-made Human RETNLB/FIZZ1/ FIZZ2 Lentiviral expression plasmid for RETNLB lentivirus packaging, RETNLB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to RETNLB/FIZZ1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000210 Human RETNLB Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000210
Gene Name RETNLB
Accession Number NM_032579
Gene ID 84666
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 336 bp
Gene Alias FIZZ1, FIZZ2, HXCP2, RELM-beta, RELMb, RELMbeta, XCP2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGGCCGTCCTCTTGCCTCCTTCTCATCCTAATCCCCCTTCTCCAGCTGATCAACCCGGGGAGTACTCAGTGTTCCTTAGACTCCGTTATGGATAAGAAGATCAAGGATGTTCTCAACAGTCTAGAGTACAGTCCCTCTCCTATAAGCAAGAAGCTCTCGTGTGCTAGTGTCAAAAGCCAAGGCAGACCGTCCTCCTGCCCTGCTGGGATGGCTGTCACTGGCTGTGCTTGTGGCTATGGCTGTGGTTCGTGGGATGTTCAGCTGGAAACCACCTGCCACTGCCAGTGCAGTGTGGTGGACTGGACCACTGCCCGCTGCTGCCACCTGACCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1240-Ab Anti-RETNB/ RETNLB/ FIZZ1 functional antibody
    Target Antigen GM-Tg-g-SE1240-Ag RETNLB protein
    ORF Viral Vector pGMLP000210 Human RETNLB Lentivirus plasmid
    ORF Viral Vector vGMLP000210 Human RETNLB Lentivirus particle
    ORF Viral Vector pGMLV002509 Human RETNLB Lentivirus plasmid


    Target information

    Target ID GM-SE1240
    Target Name RETNLB
    Gene ID 84666, 57263, 705809, 101081749, 100684690, 100061646
    Gene Symbol and Synonyms 9030012B21Rik,FIZZ1,FIZZ2,HXCP2,RELM-beta,RELMb,RELMbeta,RETNLB,XCP2,Xcp3
    Uniprot Accession Q9BQ08
    Uniprot Entry Name RETNB_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000163515
    Target Classification Not Available

    Predicted to enable hormone activity. Involved in epithelial cell proliferation. Predicted to be located in extracellular region. Predicted to be active in extracellular space. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.