Human GJB1/CMTX/CMTX1 ORF/cDNA clone-Lentivirus plasmid (NM_001097642)
Cat. No.: pGMLP000226
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human GJB1/CMTX/CMTX1 Lentiviral expression plasmid for GJB1 lentivirus packaging, GJB1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
Cx32/GJB1/CMTX products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP000226 |
Gene Name | GJB1 |
Accession Number | NM_001097642 |
Gene ID | 2705 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 852 bp |
Gene Alias | CMTX,CMTX1,CX32 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGAACTGGACAGGTTTGTACACCTTGCTCAGTGGCGTGAACCGGCATTCTACTGCCATTGGCCGAGTATGGCTCTCGGTCATCTTCATCTTCAGAATCATGGTGCTGGTGGTGGCTGCAGAGAGTGTGTGGGGTGATGAGAAATCTTCCTTCATCTGCAACACACTCCAGCCTGGCTGCAACAGCGTTTGCTATGACCAATTCTTCCCCATCTCCCATGTGCGGCTGTGGTCCCTGCAGCTCATCCTAGTTTCCACCCCAGCTCTCCTCGTGGCCATGCACGTGGCTCACCAGCAACACATAGAGAAGAAAATGCTACGGCTTGAGGGCCATGGGGACCCCCTACACCTGGAGGAGGTGAAGAGGCACAAGGTCCACATCTCAGGGACACTGTGGTGGACCTATGTCATCAGCGTGGTGTTCCGGCTGTTGTTTGAGGCCGTCTTCATGTATGTCTTTTATCTGCTCTACCCTGGCTATGCCATGGTGCGGCTGGTCAAGTGCGACGTCTACCCCTGCCCCAACACAGTGGACTGCTTCGTGTCCCGCCCCACCGAGAAAACCGTCTTCACCGTCTTCATGCTAGCTGCCTCTGGCATCTGCATCATCCTCAATGTGGCCGAGGTGGTGTACCTCATCATCCGGGCCTGTGCCCGCCGAGCCCAGCGCCGCTCCAATCCACCTTCCCGCAAGGGCTCGGGCTTCGGCCACCGCCTCTCACCTGAATACAAGCAGAATGAGATCAACAAGCTGCTGAGTGAGCAGGATGGCTCCCTGAAAGACATACTGCGCCGCAGCCCTGGCACCGGGGCTGGGCTGGCTGAAAAGAGCGACCGCTGCTCGGCCTGCTGA |
ORF Protein Sequence | MNWTGLYTLLSGVNRHSTAIGRVWLSVIFIFRIMVLVVAAESVWGDEKSSFICNTLQPGCNSVCYDQFFPISHVRLWSLQLILVSTPALLVAMHVAHQQHIEKKMLRLEGHGDPLHLEEVKRHKVHISGTLWWTYVISVVFRLLFEAVFMYVFYLLYPGYAMVRLVKCDVYPCPNTVDCFVSRPTEKTVFTVFMLAASGICIILNVAEVVYLIIRACARRAQRRSNPPSRKGSGFGHRLSPEYKQNEINKLLSEQDGSLKDILRRSPGTGAGLAEKSDRCSAC |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0141-Ab | Anti-Cx32 monoclonal antibody |
Target Antigen | GM-Tg-g-IP0141-Ag | Cx32/GJB1 protein |
ORF Viral Vector | pGMLP000226 | Human GJB1 Lentivirus plasmid |
ORF Viral Vector | vGMLP000226 | Human GJB1 Lentivirus particle |
Target information
Target ID | GM-IP0141 |
Target Name | Cx32 |
Gene ID | 2705, 14618, 706327, 29584, 101091678, 480953, 281194, 100034021 |
Gene Symbol and Synonyms | CMTX,CMTX1,Cnx32,connexin-32,CX32,Cxng,GJB1 |
Uniprot Accession | P08034 |
Uniprot Entry Name | CXB1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000169562 |
Target Classification | Not Available |
This gene encodes a member of the gap junction protein family. The gap junction proteins are membrane-spanning proteins that assemble to form gap junction channels that facilitate the transfer of ions and small molecules between cells. According to sequence similarities at the nucleotide and amino acid levels, the gap junction proteins are divided into two categories, alpha and beta. Mutations in this gene cause X-linked Charcot-Marie-Tooth disease, an inherited peripheral neuropathy. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Oct 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.