Human POLB ORF/cDNA clone-Lentivirus plasmid (NM_002690)
Pre-made Human POLB/ Lentiviral expression plasmid for POLB lentivirus packaging, POLB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to POLB/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000238 | Human POLB Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000238 |
Gene Name | POLB |
Accession Number | NM_002690 |
Gene ID | 5423 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1008 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGCAAACGGAAGGCGCCGCAGGAGACTCTCAACGGGGGAATCACCGACATGCTCACAGAACTCGCAAACTTTGAGAAGAACGTGAGCCAAGCTATCCACAAGTACAATGCTTACAGAAAAGCAGCATCTGTTATAGCAAAATACCCACACAAAATAAAGAGTGGAGCTGAAGCTAAGAAATTGCCTGGAGTAGGAACAAAAATTGCTGAAAAGATTGATGAGTTTTTAGCAACTGGAAAATTACGTAAACTGGAAAAGATTCGGCAGGATGATACGAGTTCATCCATCAATTTCCTGACTCGAGTTAGTGGCATTGGTCCATCTGCTGCAAGGAAGTTTGTAGATGAAGGAATTAAAACACTAGAAGATCTCAGAAAAAATGAAGATAAATTGAACCATCATCAGCGAATTGGGCTGAAATATTTTGGGGACTTTGAAAAAAGAATTCCTCGTGAAGAGATGTTACAAATGCAAGATATTGTACTAAATGAAGTTAAAAAAGTGGATTCTGAATACATTGCTACAGTCTGTGGCAGTTTCAGAAGAGGTGCAGAGTCCAGTGGTGACATGGATGTTCTCCTGACCCATCCCAGCTTCACTTCAGAATCAACCAAACAGCCAAAACTGTTACATCAGGTTGTGGAGCAGTTACAAAAGGTTCATTTTATCACAGATACCCTGTCAAAGGGTGAGACAAAGTTCATGGGTGTTTGCCAGCTTCCCAGTAAAAATGATGAAAAAGAATATCCACACAGAAGAATTGATATCAGGTTGATACCCAAAGATCAGTATTACTGTGGTGTTCTCTATTTCACTGGGAGTGATATTTTCAATAAGAATATGAGGGCTCATGCCCTAGAAAAGGGTTTCACAATCAATGAGTACACCATCCGTCCCTTGGGAGTCACTGGAGTTGCAGGAGAACCCCTGCCAGTGGATAGTGAAAAAGACATCTTTGATTACATCCAGTGGAAATACCGGGAACCCAAGGACCGGAGCGAATGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T06958-Ab | Anti-POLB monoclonal antibody |
Target Antigen | GM-Tg-g-T06958-Ag | POLB protein |
ORF Viral Vector | pGMLP000238 | Human POLB Lentivirus plasmid |
ORF Viral Vector | vGMLP000238 | Human POLB Lentivirus particle |
Target information
Target ID | GM-T06958 |
Target Name | POLB |
Gene ID | 5423, 18970, 704801, 29240, 101099797, 494001, 614688, 100050102 |
Gene Symbol and Synonyms | A430088C08Rik,POLB |
Uniprot Accession | P06746 |
Uniprot Entry Name | DPOLB_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000070501 |
Target Classification | Not Available |
The protein encoded by this gene is a DNA polymerase involved in base excision and repair, also called gap-filling DNA synthesis. The encoded protein, acting as a monomer, is normally found in the cytoplasm, but it translocates to the nucleus upon DNA damage. Several transcript variants of this gene exist, but the full-length nature of only one has been described to date. [provided by RefSeq, Sep 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.