Human POLB ORF/cDNA clone-Lentivirus plasmid (NM_002690)

Pre-made Human POLB/ Lentiviral expression plasmid for POLB lentivirus packaging, POLB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to POLB/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000238 Human POLB Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000238
Gene Name POLB
Accession Number NM_002690
Gene ID 5423
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1008 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGCAAACGGAAGGCGCCGCAGGAGACTCTCAACGGGGGAATCACCGACATGCTCACAGAACTCGCAAACTTTGAGAAGAACGTGAGCCAAGCTATCCACAAGTACAATGCTTACAGAAAAGCAGCATCTGTTATAGCAAAATACCCACACAAAATAAAGAGTGGAGCTGAAGCTAAGAAATTGCCTGGAGTAGGAACAAAAATTGCTGAAAAGATTGATGAGTTTTTAGCAACTGGAAAATTACGTAAACTGGAAAAGATTCGGCAGGATGATACGAGTTCATCCATCAATTTCCTGACTCGAGTTAGTGGCATTGGTCCATCTGCTGCAAGGAAGTTTGTAGATGAAGGAATTAAAACACTAGAAGATCTCAGAAAAAATGAAGATAAATTGAACCATCATCAGCGAATTGGGCTGAAATATTTTGGGGACTTTGAAAAAAGAATTCCTCGTGAAGAGATGTTACAAATGCAAGATATTGTACTAAATGAAGTTAAAAAAGTGGATTCTGAATACATTGCTACAGTCTGTGGCAGTTTCAGAAGAGGTGCAGAGTCCAGTGGTGACATGGATGTTCTCCTGACCCATCCCAGCTTCACTTCAGAATCAACCAAACAGCCAAAACTGTTACATCAGGTTGTGGAGCAGTTACAAAAGGTTCATTTTATCACAGATACCCTGTCAAAGGGTGAGACAAAGTTCATGGGTGTTTGCCAGCTTCCCAGTAAAAATGATGAAAAAGAATATCCACACAGAAGAATTGATATCAGGTTGATACCCAAAGATCAGTATTACTGTGGTGTTCTCTATTTCACTGGGAGTGATATTTTCAATAAGAATATGAGGGCTCATGCCCTAGAAAAGGGTTTCACAATCAATGAGTACACCATCCGTCCCTTGGGAGTCACTGGAGTTGCAGGAGAACCCCTGCCAGTGGATAGTGAAAAAGACATCTTTGATTACATCCAGTGGAAATACCGGGAACCCAAGGACCGGAGCGAATGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T06958-Ab Anti-POLB monoclonal antibody
    Target Antigen GM-Tg-g-T06958-Ag POLB protein
    ORF Viral Vector pGMLP000238 Human POLB Lentivirus plasmid
    ORF Viral Vector vGMLP000238 Human POLB Lentivirus particle


    Target information

    Target ID GM-T06958
    Target Name POLB
    Gene ID 5423, 18970, 704801, 29240, 101099797, 494001, 614688, 100050102
    Gene Symbol and Synonyms A430088C08Rik,POLB
    Uniprot Accession P06746
    Uniprot Entry Name DPOLB_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000070501
    Target Classification Not Available

    The protein encoded by this gene is a DNA polymerase involved in base excision and repair, also called gap-filling DNA synthesis. The encoded protein, acting as a monomer, is normally found in the cytoplasm, but it translocates to the nucleus upon DNA damage. Several transcript variants of this gene exist, but the full-length nature of only one has been described to date. [provided by RefSeq, Sep 2011]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.