Human APOL2/APOL-II/APOL3 ORF/cDNA clone-Lentivirus plasmid (NM_030882)

Cat. No.: pGMLP000302
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human APOL2/APOL-II/APOL3 Lentiviral expression plasmid for APOL2 lentivirus packaging, APOL2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to APOL2/APOL-II products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $583.92
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000302
Gene Name APOL2
Accession Number NM_030882
Gene ID 23780
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1014 bp
Gene Alias APOL-II,APOL3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAACCCAGAGAGCAGTATCTTTATTGAGGATTACCTTAAGTATTTCCAGGACCAAGTGAGCAGAGAGAATCTGCTACAACTGCTGACTGATGATGAAGCCTGGAATGGATTCGTGGCTGCTGCTGAACTGCCCAGGGATGAGGCAGATGAGCTCCGTAAAGCTCTGAACAAGCTTGCAAGTCACATGGTCATGAAGGACAAAAACCGCCACGATAAAGACCAGCAGCACAGGCAGTGGTTTTTGAAAGAGTTTCCTCGGTTGAAAAGGGAGCTTGAGGATCACATAAGGAAGCTCCGTGCCCTTGCAGAGGAGGTTGAGCAGGTCCACAGAGGCACCACCATTGCCAATGTGGTGTCCAACTCTGTTGGCACTACCTCTGGCATCCTGACCCTCCTCGGCCTGGGTCTGGCACCCTTCACAGAAGGAATCAGTTTTGTGCTCTTGGACACTGGCATGGGTCTGGGAGCAGCAGCTGCTGTGGCTGGGATTACCTGCAGTGTGGTAGAACTAGTAAACAAATTGCGGGCACGAGCCCAAGCCCGCAACTTGGACCAAAGCGGCACCAATGTAGCAAAGGTGATGAAGGAGTTTGTGGGTGGGAACACACCCAATGTTCTTACCTTAGTTGACAATTGGTACCAAGTCACACAAGGGATTGGGAGGAACATCCGTGCCATCAGACGAGCCAGAGCCAACCCTCAGTTAGGAGCGTATGCCCCACCCCCGCATGTCATTGGGCGAATCTCAGCTGAAGGCGGTGAACAGGTTGAGAGGGTTGTTGAAGGCCCCGCCCAGGCAATGAGCAGAGGAACCATGATCGTGGGTGCAGCCACTGGAGGCATCTTGCTTCTGCTGGATGTGGTCAGCCTTGCATATGAGTCAAAGCACTTGCTTGAGGGGGCAAAGTCAGAGTCAGCTGAGGAGCTGAAGAAGCGGGCTCAGGAGCTGGAGGGGAAGCTCAACTTTCTCACCAAGATCCATGAGATGCTGCAGCCAGGCCAAGACCAATGA
ORF Protein Sequence MNPESSIFIEDYLKYFQDQVSRENLLQLLTDDEAWNGFVAAAELPRDEADELRKALNKLASHMVMKDKNRHDKDQQHRQWFLKEFPRLKRELEDHIRKLRALAEEVEQVHRGTTIANVVSNSVGTTSGILTLLGLGLAPFTEGISFVLLDTGMGLGAAAAVAGITCSVVELVNKLRARAQARNLDQSGTNVAKVMKEFVGGNTPNVLTLVDNWYQVTQGIGRNIRAIRRARANPQLGAYAPPPHVIGRISAEGGEQVERVVEGPAQAMSRGTMIVGAATGGILLLLDVVSLAYESKHLLEGAKSESAEELKKRAQELEGKLNFLTKIHEMLQPGQDQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0025-Ab Anti-APOL2/ APOL-II/ APOL3 functional antibody
    Target Antigen GM-Tg-g-SE0025-Ag APOL2 protein
    ORF Viral Vector pGMLP000302 Human APOL2 Lentivirus plasmid
    ORF Viral Vector vGMLP000302 Human APOL2 Lentivirus particle


    Target information

    Target ID GM-SE0025
    Target Name APOL2
    Gene ID 23780, 694029
    Gene Symbol and Synonyms APOL-II,APOL2,APOL3
    Uniprot Accession Q9BQE5
    Uniprot Entry Name APOL2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000128335
    Target Classification Not Available

    This gene is a member of the apolipoprotein L gene family. The encoded protein is found in the cytoplasm, where it may affect the movement of lipids or allow the binding of lipids to organelles. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.