Human ARG2 ORF/cDNA clone-Lentivirus plasmid (NM_001172)

Cat. No.: pGMLP000311
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human ARG2/ Lentiviral expression plasmid for ARG2 lentivirus packaging, ARG2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to ARG2/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $598.2
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000311
Gene Name ARG2
Accession Number NM_001172
Gene ID 384
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1065 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCCCTAAGGGGCAGCCTCTCGCGTCTCCTCCAGACGCGAGTGCATTCCATCCTGAAGAAATCCGTCCACTCCGTGGCTGTGATAGGAGCCCCGTTCTCACAAGGGCAGAAAAGAAAAGGAGTGGAGCATGGTCCCGCTGCCATAAGAGAAGCTGGCTTGATGAAAAGGCTCTCCAGTTTGGGCTGCCACCTAAAAGACTTTGGAGATTTGAGTTTTACTCCAGTCCCCAAAGATGATCTCTACAACAACCTGATAGTGAATCCACGCTCAGTGGGTCTTGCCAACCAGGAACTGGCTGAGGTGGTTAGCAGAGCTGTGTCAGATGGCTACAGCTGTGTCACACTGGGAGGAGACCACAGCCTGGCAATCGGTACCATTAGTGGCCATGCCCGACACTGCCCAGACCTTTGTGTTGTCTGGGTTGATGCCCATGCTGACATCAACACACCCCTTACCACTTCATCAGGAAATCTCCATGGACAGCCAGTTTCATTTCTCCTCAGAGAACTACAGGATAAGGTACCACAACTCCCAGGATTTTCCTGGATCAAACCTTGTATCTCTTCTGCAAGTATTGTGTATATTGGTCTGAGAGACGTGGACCCTCCTGAACATTTTATTTTAAAGAACTATGATATCCAGTATTTTTCCATGAGAGATATTGATCGACTTGGTATCCAGAAGGTCATGGAACGAACATTTGATCTGCTGATTGGCAAGAGACAAAGACCAATCCATTTGAGTTTTGATATTGATGCATTTGACCCTACACTGGCTCCAGCCACAGGAACTCCTGTTGTCGGGGGACTAACCTATCGAGAAGGCATGTATATTGCTGAGGAAATACACAATACAGGGTTGCTATCAGCACTGGATCTTGTTGAAGTCAATCCTCAGTTGGCCACCTCAGAGGAAGAGGCGAAGACTACAGCTAACCTGGCAGTAGATGTGATTGCTTCAAGCTTTGGTCAGACAAGAGAAGGAGGGCATATTGTCTATGACCAACTTCCTACTCCCAGTTCACCAGATGAATCAGAAAATCAAGCACGTGTGAGAATTTAG
ORF Protein Sequence MSLRGSLSRLLQTRVHSILKKSVHSVAVIGAPFSQGQKRKGVEHGPAAIREAGLMKRLSSLGCHLKDFGDLSFTPVPKDDLYNNLIVNPRSVGLANQELAEVVSRAVSDGYSCVTLGGDHSLAIGTISGHARHCPDLCVVWVDAHADINTPLTTSSGNLHGQPVSFLLRELQDKVPQLPGFSWIKPCISSASIVYIGLRDVDPPEHFILKNYDIQYFSMRDIDRLGIQKVMERTFDLLIGKRQRPIHLSFDIDAFDPTLAPATGTPVVGGLTYREGMYIAEEIHNTGLLSALDLVEVNPQLATSEEEAKTTANLAVDVIASSFGQTREGGHIVYDQLPTPSSPDESENQARVRI

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T36806-Ab Anti-ARG2 monoclonal antibody
    Target Antigen GM-Tg-g-T36806-Ag ARG2 protein
    ORF Viral Vector pGMLP000311 Human ARG2 Lentivirus plasmid
    ORF Viral Vector pGMPC001677 Human ARG2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP000311 Human ARG2 Lentivirus particle


    Target information

    Target ID GM-T36806
    Target Name ARG2
    Gene ID 384, 11847, 711033, 29215, 101092944, 480364, 518752, 100034051
    Gene Symbol and Synonyms AII,ARG2
    Uniprot Accession P78540
    Uniprot Entry Name ARGI2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000081181
    Target Classification Not Available

    Arginase catalyzes the hydrolysis of arginine to ornithine and urea.  At least two isoforms of mammalian arginase exists (types I and II) which differ in their tissue distribution, subcellular localization, immunologic crossreactivity and physiologic function.  The type II isoform encoded by this gene, is located in the mitochondria and expressed in extra-hepatic tissues, especially kidney.  The physiologic role of this isoform is poorly understood; it is thought to play a role in nitric oxide and polyamine metabolism.  Transcript variants of the type II gene resulting from the use of alternative polyadenylation sites have been described. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.