Human WDR33/NET14/WDC146 ORF/cDNA clone-Lentivirus plasmid (NM_001006622)

Cat. No.: pGMLP000616
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human WDR33/NET14/WDC146 Lentiviral expression plasmid for WDR33 lentivirus packaging, WDR33 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to WDR33/NET14 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $545.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000616
Gene Name WDR33
Accession Number NM_001006622
Gene ID 55339
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 981 bp
Gene Alias NET14,WDC146
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCTACAGAAATTGGTTCTCCTCCTCGTTTTTTCCATATGCCAAGGTTCCAGCACCAGGCACCTCGACAGCTGTTTTATAAGCGACCTGATTTTGCACAACAGCAAGCAATGCAACAGCTTACTTTTGATGGAAAACGAATGAGAAAAGCTGTGAACCGAAAAACCATAGACTACAATCCATCTGTAATTAAGTATTTGGAGAACAGAATATGGCAAAGAGACCAGAGAGATATGCGGGCAATTCAGCCTGATGCAGGTTATTACAATGATCTGGTCCCACCTATAGGAATGTTGAATAATCCTATGAATGCAGTAACAACAAAATTTGTTCGGACATCAACAAATAAAGTAAAGTGTCCTGTATTTGTTGTTAGGTGGACTCCAGAAGGAAGACGCTTGGTCACTGGAGCTTCTAGTGGGGAGTTTACCCTGTGGAATGGACTCACTTTCAATTTTGAAACAATATTACAGGCTCACGACAGCCCAGTGAGGGCCATGACGTGGTCACATAATGACATGTGGATGTTGACAGCAGACCACGGAGGATATGTGAAATATTGGCAGTCGAACATGAACAACGTCAAGATGTTCCAGGCACATAAGGAGGCGATTAGAGAGGCCAGGTTTATACACAATATACCATTTTCTGTAGTCCCTATTGTCATGGTTAAATTATTCTCTAAGTGTATTCTGGGTGCAGAGATGCATGGGCTCTGTCAGTTTCTGGGAAACTTTCTGCACCCTATAAACACAATATTTTTCTTTGTTTTCACACATTCACCATTTTGCTGGCACCTTTCTGAAGTAGTGTTGTCCCGGTATCAGCCTTTGCAATATGTTAGAGATGTACTGTCTGCCGCATTTTGCACTGGTTTTCTCTTTTCATTTATGATTAATAATGTGTATACGTTATTCCTTTTTATTATCTACTGTGTAAGACAAGAATATTTCATTCCAAATAAAGAATTCAGTCTTTAA
ORF Protein Sequence MATEIGSPPRFFHMPRFQHQAPRQLFYKRPDFAQQQAMQQLTFDGKRMRKAVNRKTIDYNPSVIKYLENRIWQRDQRDMRAIQPDAGYYNDLVPPIGMLNNPMNAVTTKFVRTSTNKVKCPVFVVRWTPEGRRLVTGASSGEFTLWNGLTFNFETILQAHDSPVRAMTWSHNDMWMLTADHGGYVKYWQSNMNNVKMFQAHKEAIREARFIHNIPFSVVPIVMVKLFSKCILGAEMHGLCQFLGNFLHPINTIFFFVFTHSPFCWHLSEVVLSRYQPLQYVRDVLSAAFCTGFLFSFMINNVYTLFLFIIYCVRQEYFIPNKEFSL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2277-Ab Anti-WDR33 monoclonal antibody
    Target Antigen GM-Tg-g-IP2277-Ag WDR33 protein
    ORF Viral Vector pGMLP000616 Human WDR33 Lentivirus plasmid
    ORF Viral Vector vGMLP000616 Human WDR33 Lentivirus particle


    Target information

    Target ID GM-IP2277
    Target Name WDR33
    Gene ID 55339, 74320, 699696, 307524, 101092953, 100856093, 541270, 100067505
    Gene Symbol and Synonyms 1110001N06Rik,2310011G05Rik,2810021O11Rik,8430413N20Rik,NET14,WDC146,WDR33
    Uniprot Accession Q9C0J8
    Uniprot Entry Name WDR33_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000136709
    Target Classification Not Available

    This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene is highly expressed in testis and the protein is localized to the nucleus. This gene may play important roles in the mechanisms of cytodifferentiation and/or DNA recombination. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.