Human FABP4/A-FABP/AFABP ORF/cDNA clone-Lentivirus plasmid (NM_001442)

Cat. No.: pGMLP000634
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human FABP4/A-FABP/AFABP Lentiviral expression plasmid for FABP4 lentivirus packaging, FABP4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to FABP4/A-FABP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000634
Gene Name FABP4
Accession Number NM_001442
Gene ID 2167
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 399 bp
Gene Alias A-FABP,AFABP,ALBP,aP2,HEL-S-104
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTGTGATGCTTTTGTAGGTACCTGGAAACTTGTCTCCAGTGAAAACTTTGATGATTATATGAAAGAAGTAGGAGTGGGCTTTGCCACCAGGAAAGTGGCTGGCATGGCCAAACCTAACATGATCATCAGTGTGAATGGGGATGTGATCACCATTAAATCTGAAAGTACCTTTAAAAATACTGAGATTTCCTTCATACTGGGCCAGGAATTTGACGAAGTCACTGCAGATGACAGGAAAGTCAAGAGCACCATAACCTTAGATGGGGGTGTCCTGGTACATGTGCAGAAATGGGATGGAAAATCAACCACCATAAAGAGAAAACGAGAGGATGATAAACTGGTGGTGGAATGCGTCATGAAAGGCGTCACTTCCACGAGAGTTTATGAGAGAGCATAA
ORF Protein Sequence MCDAFVGTWKLVSSENFDDYMKEVGVGFATRKVAGMAKPNMIISVNGDVITIKSESTFKNTEISFILGQEFDEVTADDRKVKSTITLDGGVLVHVQKWDGKSTTIKRKREDDKLVVECVMKGVTSTRVYERA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T07217-Ab Anti-FABP4 monoclonal antibody
    Target Antigen GM-Tg-g-T07217-Ag FABP4 protein
    ORF Viral Vector pGMLP000634 Human FABP4 Lentivirus plasmid
    ORF Viral Vector pGMPC000894 Human FABP4 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP000634 Human FABP4 Lentivirus particle


    Target information

    Target ID GM-T07217
    Target Name FABP4
    Gene ID 2167, 11770, 701365, 79451, 101087449, 608476
    Gene Symbol and Synonyms 422/aP2,A-FABP,AFABP,ALBP,ALBP/Ap2,aP2,FABP4,HEL-S-104,Lbpl,P15
    Uniprot Accession P15090
    Uniprot Entry Name FABP4_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Bladder Cell Carcinomas
    Gene Ensembl ENSG00000170323
    Target Classification Not Available

    FABP4 encodes the fatty acid binding protein found in adipocytes.  Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.