Human NR0B1/AHC/AHCH ORF/cDNA clone-Lentivirus plasmid (NM_000475)

Cat. No.: pGMLP000652
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human NR0B1/AHC/AHCH Lentiviral expression plasmid for NR0B1 lentivirus packaging, NR0B1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to NR0B1/AHC products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $695.64
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000652
Gene Name NR0B1
Accession Number NM_000475
Gene ID 190
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1413 bp
Gene Alias AHC,AHCH,AHX,DAX-1,DAX1,DSS,GTD,HHG,NROB1,SRXY2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGGGCGAGAACCACCAGTGGCAGGGCAGCATCCTCTACAACATGCTTATGAGCGCGAAGCAAACGCGCGCGGCTCCTGAGGCTCCAGAGACGCGGCTGGTGGATCAGTGCTGGGGCTGTTCGTGCGGCGATGAGCCCGGGGTGGGCAGAGAGGGGCTGCTGGGCGGGCGGAACGTGGCGCTCCTGTACCGCTGCTGCTTTTGCGGTAAAGACCACCCACGGCAGGGCAGCATCCTCTACAGCATGCTGACGAGCGCAAAGCAAACGTACGCGGCACCGAAGGCGCCCGAGGCGACGCTGGGTCCGTGCTGGGGCTGTTCGTGCGGCTCTGATCCCGGGGTGGGCAGAGCGGGGCTTCCGGGTGGGCGGCCCGTGGCACTCCTGTACCGCTGCTGCTTTTGTGGTGAAGACCACCCGCGGCAGGGCAGCATCCTCTACAGCTTGCTCACTAGCTCAAAGCAAACGCACGTGGCTCCGGCAGCGCCCGAGGCACGGCCAGGGGGCGCGTGGTGGGACCGCTCCTACTTCGCGCAGAGGCCAGGGGGTAAAGAGGCGCTACCAGGCGGGCGGGCCACGGCGCTTCTGTACCGCTGCTGCTTTTGCGGTGAAGACCACCCGCAGCAGGGCAGCACCCTCTACTGCGTGCCCACGAGCACAAATCAAGCGCAGGCGGCTCCGGAGGAGCGGCCGAGGGCCCCCTGGTGGGACACCTCCTCTGGTGCGCTGCGGCCGGTGGCGCTCAAGAGTCCACAGGTGGTCTGCGAGGCAGCCTCAGCGGGCCTGTTGAAGACGCTGCGCTTCGTCAAGTACTTGCCCTGCTTCCAGGTGCTGCCCCTGGACCAGCAGCTGGTGCTGGTGCGCAACTGCTGGGCGTCCCTGCTCATGCTTGAGCTGGCCCAGGACCGCTTGCAGTTCGAGACTGTGGAAGTCTCGGAGCCCAGCATGCTGCAGAAGATCCTCACCACCAGGCGGCGGGAGACCGGGGGCAACGAGCCACTGCCCGTGCCCACGCTGCAGCACCATTTGGCACCGCCGGCGGAGGCCAGGAAGGTGCCCTCCGCCTCCCAGGTCCAAGCCATCAAGTGCTTTCTTTCCAAATGCTGGAGTCTGAACATCAGTACCAAGGAGTACGCCTACCTCAAGGGGACCGTGCTCTTTAACCCGGACGTGCCGGGCCTGCAGTGCGTGAAGTACATTCAGGGACTCCAGTGGGGAACTCAGCAAATACTCAGTGAACACACCAGGATGACGCACCAAGGGCCCCATGACAGATTCATCGAACTTAATAGTACCCTTTTCCTGCTGAGATTCATCAATGCCAATGTCATTGCTGAACTGTTCTTCAGGCCCATCATCGGCACAGTCAGCATGGATGATATGATGCTGGAAATGCTCTGTACAAAGATATAA
ORF Protein Sequence MAGENHQWQGSILYNMLMSAKQTRAAPEAPETRLVDQCWGCSCGDEPGVGREGLLGGRNVALLYRCCFCGKDHPRQGSILYSMLTSAKQTYAAPKAPEATLGPCWGCSCGSDPGVGRAGLPGGRPVALLYRCCFCGEDHPRQGSILYSLLTSSKQTHVAPAAPEARPGGAWWDRSYFAQRPGGKEALPGGRATALLYRCCFCGEDHPQQGSTLYCVPTSTNQAQAAPEERPRAPWWDTSSGALRPVALKSPQVVCEAASAGLLKTLRFVKYLPCFQVLPLDQQLVLVRNCWASLLMLELAQDRLQFETVEVSEPSMLQKILTTRRRETGGNEPLPVPTLQHHLAPPAEARKVPSASQVQAIKCFLSKCWSLNISTKEYAYLKGTVLFNPDVPGLQCVKYIQGLQWGTQQILSEHTRMTHQGPHDRFIELNSTLFLLRFINANVIAELFFRPIIGTVSMDDMMLEMLCTKI

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T23191-Ab Anti-NR0B1 monoclonal antibody
    Target Antigen GM-Tg-g-T23191-Ag NR0B1 protein
    ORF Viral Vector pGMLP000652 Human NR0B1 Lentivirus plasmid
    ORF Viral Vector vGMLP000652 Human NR0B1 Lentivirus particle


    Target information

    Target ID GM-T23191
    Target Name NR0B1
    Gene ID 190, 11614, 574154, 58850, 101100624, 119868269, 281949, 100033899
    Gene Symbol and Synonyms AHC,AHCH,AHX,DAX-1,DAX1,DSS,GTD,HHG,LOC119868269,NR0B1,NROB1,SRXY2
    Uniprot Accession P51843
    Uniprot Entry Name NR0B1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000169297
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a protein that contains a DNA-binding domain. The encoded protein acts as a dominant-negative regulator of transcription which is mediated by the retinoic acid receptor. This protein also functions as an anti-testis gene by acting antagonistically to Sry. Mutations in this gene result in both X-linked congenital adrenal hypoplasia and hypogonadotropic hypogonadism. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.