Human C20orf141/dJ860F19.4 ORF/cDNA clone-Lentivirus plasmid (NM_080739)

Cat. No.: pGMLP000671
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human C20orf141/dJ860F19.4 Lentiviral expression plasmid for C20orf141 lentivirus packaging, C20orf141 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to C20orf141/dJ860F19.4 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000671
Gene Name C20orf141
Accession Number NM_080739
Gene ID 128653
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 498 bp
Gene Alias dJ860F19.4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACCCGGCTCTGCTTACCCAGACCCGAAGCACGTGAGGATCCGATCCCAGTTCCTCCAAGGGGCCTGGGTGCTGGGGAGGGGTCAGGTAGTCCAGTGCGTCCACCTGTATCCACCTGGGGCCCTAGCTGGGCCCAGCTCCTGGACAGTGTCCTATGGCTGGGGGCACTAGGACTGACAATCCAGGCAGTCTTTTCCACCACTGGCCCAGCCCTGCTGCTGCTTCTGGTCAGCTTCCTCACCTTTGACCTGCTCCATAGGCCCGCAGGTCACACTCTGCCACAGCGCAAACTTCTCACCAGGGGCCAGAGTCAGGGGGCCGGTGAAGGTCCTGGACAGCAGGAGGCTCTACTCCTGCAAATGGGTACAGTCTCAGGACAACTTAGCCTCCAGGACGCACTGCTGCTGCTGCTCATGGGGCTGGGCCCGCTCCTGAGAGCCTGTGGCATGCCCTTGACCCTGCTTGGCCTGGCTTTCTGCCTCCATCCTTGGGCCTGA
ORF Protein Sequence MTRLCLPRPEAREDPIPVPPRGLGAGEGSGSPVRPPVSTWGPSWAQLLDSVLWLGALGLTIQAVFSTTGPALLLLLVSFLTFDLLHRPAGHTLPQRKLLTRGQSQGAGEGPGQQEALLLQMGTVSGQLSLQDALLLLLMGLGPLLRACGMPLTLLGLAFCLHPWA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0464-Ab Anti-C20orf141 monoclonal antibody
    Target Antigen GM-Tg-g-IP0464-Ag C20orf141 protein
    ORF Viral Vector pGMLP000671 Human C20orf141 Lentivirus plasmid
    ORF Viral Vector vGMLP000671 Human C20orf141 Lentivirus particle


    Target information

    Target ID GM-IP0464
    Target Name C20orf141
    Gene ID 128653, 75656, 100426415, 101082483, 100684543, 788725, 100052920
    Gene Symbol and Synonyms 1700020A23Rik,C10H20orf141,C13H20orf141,C20orf141,C22H20orf141,C24H20orf141,CA3H20orf141,dJ860F19.4
    Uniprot Accession Q9NUB4
    Uniprot Entry Name CT141_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000258713
    Target Classification Not Available

    Predicted to be integral component of membrane. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.