Human PGF/D12S1900/ PGFL ORF/cDNA clone-Lentivirus plasmid (NM_002632)

Pre-made Human PGF/D12S1900/ PGFL Lentiviral expression plasmid for PGF lentivirus packaging, PGF lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to PlGF/PGF/D12S1900 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000680 Human PGF Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000680
Gene Name PGF
Accession Number NM_002632
Gene ID 5228
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 513 bp
Gene Alias D12S1900, PGFL, PIGF, PLGF, PlGF-2, SHGC-10760
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCCGGTCATGAGGCTGTTCCCTTGCTTCCTGCAGCTCCTGGCCGGGCTGGCGCTGCCTGCTGTGCCCCCCCAGCAGTGGGCCTTGTCTGCTGGGAACGGCTCGTCAGAGGTGGAAGTGGTACCCTTCCAGGAAGTGTGGGGCCGCAGCTACTGCCGGGCGCTGGAGAGGCTGGTGGACGTCGTGTCCGAGTACCCCAGCGAGGTGGAGCACATGTTCAGCCCATCCTGTGTCTCCCTGCTGCGCTGCACCGGCTGCTGCGGCGATGAGAATCTGCACTGTGTGCCGGTGGAGACGGCCAATGTCACCATGCAGCTCCTAAAGATCCGTTCTGGGGACCGGCCCTCCTACGTGGAGCTGACGTTCTCTCAGCACGTTCGCTGCGAATGCCGGCCTCTGCGGGAGAAGATGAAGCCGGAAAGGAGGAGACCCAAGGGCAGGGGGAAGAGGAGGAGAGAGAAGCAGAGACCCACAGACTGCCACCTGTGCGGCGATGCTGTTCCCCGGAGGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T70792-Ab Anti-PLGF/ PlGF/ PGF functional antibody
    Target Antigen GM-Tg-g-T70792-Ag PlGF/PGF protein
    Cytokine cks-Tg-g-GM-T70792 placental growth factor (PGF) protein & antibody
    ORF Viral Vector pGMLP000680 Human PGF Lentivirus plasmid
    ORF Viral Vector vGMLP000680 Human PGF Lentivirus particle


    Target information

    Target ID GM-T70792
    Target Name PlGF
    Gene ID 5228, 18654, 701219, 94203, 101095904, 100855780, 280894, 100051349
    Gene Symbol and Synonyms D12S1900,PGF,PGFL,PIGF,PLGF,PlGF-2,SHGC-10760
    Uniprot Accession P49763
    Uniprot Entry Name PLGF_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Diagnostics Biomarker, Cytokine Target
    Disease Impaired renal function disease, Pre-eclampsia
    Gene Ensembl ENSG00000119630
    Target Classification Not Available

    This gene encodes a growth factor found in placenta which is homologous to vascular endothelial growth factor. Alternatively spliced transcripts encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2011]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.