Human MRPL27/L27mt ORF/cDNA clone-Lentivirus plasmid (NM_016504)
Pre-made Human MRPL27/L27mt Lentiviral expression plasmid for MRPL27 lentivirus packaging, MRPL27 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to MRPL27/L27mt products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000690 | Human MRPL27 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000690 |
Gene Name | MRPL27 |
Accession Number | NM_016504 |
Gene ID | 51264 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 447 bp |
Gene Alias | L27mt |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCGTCGGTGGTGTTGGCGCTGAGGACCCGGACAGCCGTTACATCCTTGCTAAGCCCCACTCCGGCTACAGCTCTTGCTGTCAGATACGCATCCAAGAAGTCGGGTGGTAGCTCCAAAAACCTCGGTGGAAAGTCATCAGGCAGACGCCAAGGCATTAAGAAAATGGAAGGTCACTATGTTCATGCTGGGAACATCATTGCAACACAGCGCCATTTCCGCTGGCACCCAGGTGCCCATGTGGGTGTTGGGAAGAATAAATGTCTGTATGCCCTGGAAGAGGGGATAGTCCGCTACACTAAGGAGGTCTACGTGCCTCATCCCAGAAACACGGAGGCTGTGGATCTGATCACCAGGCTGCCCAAGGGTGCTGTGCTCTACAAGACTTTTGTCCACGTGGTTCCTGCCAAGCCTGAGGGCACCTTCAAACTGGTAGCTATGCTTTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1456-Ab | Anti-RM27/ MRPL27/ L27mt functional antibody |
Target Antigen | GM-Tg-g-SE1456-Ag | MRPL27 protein |
ORF Viral Vector | pGMLP000690 | Human MRPL27 Lentivirus plasmid |
ORF Viral Vector | vGMLP000690 | Human MRPL27 Lentivirus particle |
Target information
Target ID | GM-SE1456 |
Target Name | MRPL27 |
Gene ID | 51264, 94064, 702151, 287635, 101091738, 491078, 510058, 100069911 |
Gene Symbol and Synonyms | A630055F16Rik,D11Moh47,D18Ertd643e,L27mt,MRPL27 |
Uniprot Accession | Q9P0M9 |
Uniprot Entry Name | RM27_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000108826 |
Target Classification | Not Available |
Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.