Human STARD3NL/MENTHO ORF/cDNA clone-Lentivirus plasmid (NM_032016)

Cat. No.: pGMLP000694
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human STARD3NL/MENTHO Lentiviral expression plasmid for STARD3NL lentivirus packaging, STARD3NL lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to STARD3NL/MENTHO products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $476.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000694
Gene Name STARD3NL
Accession Number NM_032016
Gene ID 83930
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 705 bp
Gene Alias MENTHO
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAACCACCTGCCAGAAGACATGGAGAACGCTCTCACCGGGAGCCAGAGCTCCCATGCTTCTCTGCGCAATATCCATTCCATCAACCCCACACAACTCATGGCCAGGATTGAGTCCTATGAAGGAAGGGAAAAGAAAGGCATATCTGATGTCAGGAGGACTTTCTGTTTGTTTGTCACCTTTGACCTCTTATTCGTAACATTACTGTGGATAATAGAGTTAAATGTGAATGGAGGCATTGAGAACACATTAGAGAAGGAGGTGATGCAGTATGACTACTATTCTTCATATTTTGATATATTTCTTCTGGCAGTTTTTCGATTTAAAGTGTTAATACTTGCATATGCTGTGTGCAGACTGCGCCATTGGTGGGCAATAGCGTTGACAACGGCAGTGACCAGTGCCTTTTTACTAGCAAAAGTGATCCTTTCGAAGCTTTTCTCTCAAGGGGCTTTTGGCTATGTGCTGCCCATCATTTCATTCATCCTTGCCTGGATTGAGACGTGGTTCCTGGATTTCAAAGTGTTACCTCAAGAAGCAGAAGAAGAAAACAGACTCCTGATAGTTCAGGATGCTTCAGAGAGGGCAGCACTTATACCTGGTGGTCTTTCTGATGGTCAGTTTTATTCCCCTCCTGAATCCGAAGCAGGATCTGAAGAAGCTGAAGAAAAACAGGACAGTGAGAAACCACTTTTAGAACTATGA
ORF Protein Sequence MNHLPEDMENALTGSQSSHASLRNIHSINPTQLMARIESYEGREKKGISDVRRTFCLFVTFDLLFVTLLWIIELNVNGGIENTLEKEVMQYDYYSSYFDIFLLAVFRFKVLILAYAVCRLRHWWAIALTTAVTSAFLLAKVILSKLFSQGAFGYVLPIISFILAWIETWFLDFKVLPQEAEEENRLLIVQDASERAALIPGGLSDGQFYSPPESEAGSEEAEEKQDSEKPLLEL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1840-Ab Anti-STARD3NL monoclonal antibody
    Target Antigen GM-Tg-g-IP1840-Ag STARD3NL protein
    ORF Viral Vector pGMLP000694 Human STARD3NL Lentivirus plasmid
    ORF Viral Vector vGMLP000694 Human STARD3NL Lentivirus particle


    Target information

    Target ID GM-IP1840
    Target Name STARD3NL
    Gene ID 83930, 76205, 705212, 291182, 101092753, 483257, 510042, 100051143
    Gene Symbol and Synonyms 0610035N01Rik,6530409L22Rik,MENTHO,STARD3NL
    Uniprot Accession O95772
    Uniprot Entry Name STR3N_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000010270
    Target Classification Not Available

    This gene encodes a late-endosomal protein that contains a conserved MENTAL (MLN64 N-terminal) domain. The encoded protein binds cholesterol molecules and may play a role in endosomal cholesterol transport through interactions with metastatic lymph node protein 64 (MLN64). [provided by RefSeq, Sep 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.