Human STARD3NL/MENTHO ORF/cDNA clone-Lentivirus plasmid (NM_032016)
Cat. No.: pGMLP000694
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human STARD3NL/MENTHO Lentiviral expression plasmid for STARD3NL lentivirus packaging, STARD3NL lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
STARD3NL/MENTHO products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP000694 |
Gene Name | STARD3NL |
Accession Number | NM_032016 |
Gene ID | 83930 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 705 bp |
Gene Alias | MENTHO |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGAACCACCTGCCAGAAGACATGGAGAACGCTCTCACCGGGAGCCAGAGCTCCCATGCTTCTCTGCGCAATATCCATTCCATCAACCCCACACAACTCATGGCCAGGATTGAGTCCTATGAAGGAAGGGAAAAGAAAGGCATATCTGATGTCAGGAGGACTTTCTGTTTGTTTGTCACCTTTGACCTCTTATTCGTAACATTACTGTGGATAATAGAGTTAAATGTGAATGGAGGCATTGAGAACACATTAGAGAAGGAGGTGATGCAGTATGACTACTATTCTTCATATTTTGATATATTTCTTCTGGCAGTTTTTCGATTTAAAGTGTTAATACTTGCATATGCTGTGTGCAGACTGCGCCATTGGTGGGCAATAGCGTTGACAACGGCAGTGACCAGTGCCTTTTTACTAGCAAAAGTGATCCTTTCGAAGCTTTTCTCTCAAGGGGCTTTTGGCTATGTGCTGCCCATCATTTCATTCATCCTTGCCTGGATTGAGACGTGGTTCCTGGATTTCAAAGTGTTACCTCAAGAAGCAGAAGAAGAAAACAGACTCCTGATAGTTCAGGATGCTTCAGAGAGGGCAGCACTTATACCTGGTGGTCTTTCTGATGGTCAGTTTTATTCCCCTCCTGAATCCGAAGCAGGATCTGAAGAAGCTGAAGAAAAACAGGACAGTGAGAAACCACTTTTAGAACTATGA |
ORF Protein Sequence | MNHLPEDMENALTGSQSSHASLRNIHSINPTQLMARIESYEGREKKGISDVRRTFCLFVTFDLLFVTLLWIIELNVNGGIENTLEKEVMQYDYYSSYFDIFLLAVFRFKVLILAYAVCRLRHWWAIALTTAVTSAFLLAKVILSKLFSQGAFGYVLPIISFILAWIETWFLDFKVLPQEAEEENRLLIVQDASERAALIPGGLSDGQFYSPPESEAGSEEAEEKQDSEKPLLEL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP1840-Ab | Anti-STARD3NL monoclonal antibody |
Target Antigen | GM-Tg-g-IP1840-Ag | STARD3NL protein |
ORF Viral Vector | pGMLP000694 | Human STARD3NL Lentivirus plasmid |
ORF Viral Vector | vGMLP000694 | Human STARD3NL Lentivirus particle |
Target information
Target ID | GM-IP1840 |
Target Name | STARD3NL |
Gene ID | 83930, 76205, 705212, 291182, 101092753, 483257, 510042, 100051143 |
Gene Symbol and Synonyms | 0610035N01Rik,6530409L22Rik,MENTHO,STARD3NL |
Uniprot Accession | O95772 |
Uniprot Entry Name | STR3N_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000010270 |
Target Classification | Not Available |
This gene encodes a late-endosomal protein that contains a conserved MENTAL (MLN64 N-terminal) domain. The encoded protein binds cholesterol molecules and may play a role in endosomal cholesterol transport through interactions with metastatic lymph node protein 64 (MLN64). [provided by RefSeq, Sep 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.