Human SOSTDC1/CDA019/DAND7 ORF/cDNA clone-Lentivirus plasmid (NM_015464)

Cat. No.: pGMLP000702
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SOSTDC1/CDA019/DAND7 Lentiviral expression plasmid for SOSTDC1 lentivirus packaging, SOSTDC1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to SOSTDC1/CDA019 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $455.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000702
Gene Name SOSTDC1
Accession Number NM_015464
Gene ID 25928
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 621 bp
Gene Alias CDA019,DAND7,ECTODIN,USAG1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTTCCTCCTGCCATTCATTTCTATCTCCTTCCCCTTGCATGCATCCTAATGAAAAGCTGTTTGGCTTTTAAAAATGATGCCACAGAAATCCTTTATTCACATGTGGTTAAACCTGTTCCAGCACACCCCAGCAGCAACAGCACGTTGAATCAAGCCAGAAATGGAGGCAGGCATTTCAGTAACACTGGACTGGATCGGAACACTCGGGTTCAAGTGGGTTGCCGGGAACTGCGTTCCACCAAATACATCTCTGATGGCCAGTGCACCAGCATCAGCCCTCTGAAGGAGCTGGTGTGTGCTGGCGAGTGCTTGCCCCTGCCAGTGCTCCCTAACTGGATTGGAGGAGGCTATGGAACAAAGTACTGGAGCAGGAGGAGCTCCCAGGAGTGGCGGTGTGTCAATGACAAAACCCGTACCCAGAGAATCCAGCTGCAGTGCCAAGATGGCAGCACACGCACCTACAAAATCACAGTAGTCACTGCCTGCAAGTGCAAGAGGTACACCCGGCAGCACAACGAGTCCAGTCACAACTTTGAGAGCATGTCACCTGCCAAGCCAGTCCAGCATCACAGAGAGCGGAAAAGAGCCAGCAAATCCAGCAAGCACAGCATGAGTTAG
ORF Protein Sequence MLPPAIHFYLLPLACILMKSCLAFKNDATEILYSHVVKPVPAHPSSNSTLNQARNGGRHFSNTGLDRNTRVQVGCRELRSTKYISDGQCTSISPLKELVCAGECLPLPVLPNWIGGGYGTKYWSRRSSQEWRCVNDKTRTQRIQLQCQDGSTRTYKITVVTACKCKRYTRQHNESSHNFESMSPAKPVQHHRERKRASKSSKHSMS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1301-Ab Anti-SOSD1/ SOSTDC1/ CDA019 functional antibody
    Target Antigen GM-Tg-g-SE1301-Ag SOSTDC1 protein
    ORF Viral Vector pGMLP000702 Human SOSTDC1 Lentivirus plasmid
    ORF Viral Vector vGMLP000702 Human SOSTDC1 Lentivirus particle


    Target information

    Target ID GM-SE1301
    Target Name SOSTDC1
    Gene ID 25928, 66042, 709577, 266803, 101083758, 102152602, 523184, 100052877
    Gene Symbol and Synonyms 0610006G05Rik,CDA019,DAND7,ECTODIN,SOSTDC1,Sostl,USAG-1,USAG1,Wise
    Uniprot Accession Q6X4U4
    Uniprot Entry Name SOSD1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000171243
    Target Classification Not Available

    This gene is a member of the sclerostin family and encodes an N-glycosylated, secreted protein with a C-terminal cystine knot-like domain. This protein functions as a bone morphogenetic protein (BMP) antagonist. Specifically, it directly associates with BMPs, prohibiting them from binding their receptors, thereby regulating BMP signaling during cellular proliferation, differentiation, and programmed cell death. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.