Human KISS1/HH13/KiSS-1 ORF/cDNA clone-Lentivirus plasmid (NM_002256)

Cat. No.: pGMLP000901
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human KISS1/HH13/KiSS-1 Lentiviral expression plasmid for KISS1 lentivirus packaging, KISS1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to KISS1/HH13 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000901
Gene Name KISS1
Accession Number NM_002256
Gene ID 3814
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 417 bp
Gene Alias HH13,KiSS-1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAACTCACTGGTTTCTTGGCAGCTACTGCTTTTCCTCTGTGCCACCCACTTTGGGGAGCCATTAGAAAAGGTGGCCTCTGTGGGGAATTCTAGACCCACAGGCCAGCAGCTAGAATCCCTGGGCCTCCTGGCCCCCGGGGAGCAGAGCCTGCCGTGCACCGAGAGGAAGCCAGCTGCTACTGCCAGGCTGAGCCGTCGGGGGACCTCGCTGTCCCCGCCCCCCGAGAGCTCCGGGAGCCCCCAGCAGCCGGGCCTGTCCGCCCCCCACAGCCGCCAGATCCCCGCACCCCAGGGCGCGGTGCTGGTGCAGCGGGAGAAGGACCTGCCGAACTACAACTGGAACTCCTTCGGCCTGCGCTTCGGCAAGCGGGAGGCGGCACCAGGGAACCACGGCAGAAGCGCTGGGCGGGGCTGA
ORF Protein Sequence MNSLVSWQLLLFLCATHFGEPLEKVASVGNSRPTGQQLESLGLLAPGEQSLPCTERKPAATARLSRRGTSLSPPPESSGSPQQPGLSAPHSRQIPAPQGAVLVQREKDLPNYNWNSFGLRFGKREAAPGNHGRSAGRG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T18872-Ab Anti-KISS1/ HH13/ KiSS-1 functional antibody
    Target Antigen GM-Tg-g-T18872-Ag KISS1 protein
    ORF Viral Vector pGMLP000901 Human KISS1 Lentivirus plasmid
    ORF Viral Vector vGMLP000901 Human KISS1 Lentivirus particle


    Target information

    Target ID GM-T18872
    Target Name KISS1
    Gene ID 3814, 280287, 574306, 289023, 101083480, 106558365, 615613, 100054297
    Gene Symbol and Synonyms Eseptin,HH13,KiSS-1,KISS1,kisspeptin,metastatin
    Uniprot Accession Q15726
    Uniprot Entry Name KISS1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000170498
    Target Classification Tumor-associated antigen (TAA)

    This gene is a metastasis suppressor gene that suppresses metastases of melanomas and breast carcinomas without affecting tumorigenicity. The encoded protein may inhibit chemotaxis and invasion and thereby attenuate metastasis in malignant melanomas. Studies suggest a putative role in the regulation of events downstream of cell-matrix adhesion, perhaps involving cytoskeletal reorganization. A protein product of this gene, kisspeptin, stimulates gonadotropin-releasing hormone (GnRH)-induced gonadotropin secretion and regulates the pubertal activation of GnRH neurons. A polymorphism in the terminal exon of this mRNA results in two protein isoforms. An adenosine present at the polymorphic site represents the third position in a stop codon. When the adenosine is absent, a downstream stop codon is utilized and the encoded protein extends for an additional seven amino acid residues. [provided by RefSeq, Jun 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.