Human CDK3 ORF/cDNA clone-Lentivirus plasmid (NM_001258)

Cat. No.: pGMLP001003
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CDK3/ Lentiviral expression plasmid for CDK3 lentivirus packaging, CDK3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to CDK3/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $529.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001003
Gene Name CDK3
Accession Number NM_001258
Gene ID 1018
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 918 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGATATGTTCCAGAAGGTAGAGAAGATCGGAGAGGGCACCTATGGGGTGGTGTACAAGGCCAAGAACAGGGAGACAGGGCAGCTGGTGGCCCTGAAGAAGATCAGACTGGATTTGGAGATGGAGGGGGTCCCAAGCACTGCCATCAGGGAGATCTCGCTGCTCAAGGAACTGAAGCACCCCAACATCGTCCGACTGCTGGACGTGGTGCACAACGAGAGGAAGCTCTATCTGGTGTTTGAGTTCCTCAGCCAGGACCTGAAGAAGTACATGGACTCCACCCCAGGCTCAGAGCTCCCCCTGCACCTCATCAAGAGCTACCTCTTCCAGCTGCTGCAGGGGGTGAGTTTCTGCCACTCACATCGGGTCATCCACCGAGACCTGAAGCCCCAGAACCTGCTCATCAATGAGTTGGGTGCCATCAAGCTGGCTGACTTCGGCCTGGCTCGCGCCTTCGGGGTGCCCCTGCGCACCTACACCCATGAGGTGGTGACACTGTGGTATCGCGCCCCCGAGATTCTCTTGGGCAGCAAGTTCTATACCACAGCTGTGGATATCTGGAGCATTGGTTGCATCTTTGCAGAGATGGTGACTCGAAAAGCCCTGTTTCCTGGTGACTCTGAGATTGACCAGCTCTTTCGTATCTTTCGTATGCTGGGGACACCCAGCGAAGACACATGGCCCGGGGTCACCCAGCTGCCTGACTATAAGGGCAGCTTCCCTAAGTGGACCAGGAAGGGACTGGAAGAGATTGTGCCCAATCTGGAGCCAGAGGGCAGGGACCTGCTCATGCAACTCCTGCAGTATGACCCCAGCCAGCGGATCACAGCCAAGACTGCCCTGGCCCACCCGTACTTCTCATCCCCTGAGCCCTCCCCAGCTGCCCGCCAGTATGTGCTGCAGCGATTCCGCCATTGA
ORF Protein Sequence MDMFQKVEKIGEGTYGVVYKAKNRETGQLVALKKIRLDLEMEGVPSTAIREISLLKELKHPNIVRLLDVVHNERKLYLVFEFLSQDLKKYMDSTPGSELPLHLIKSYLFQLLQGVSFCHSHRVIHRDLKPQNLLINELGAIKLADFGLARAFGVPLRTYTHEVVTLWYRAPEILLGSKFYTTAVDIWSIGCIFAEMVTRKALFPGDSEIDQLFRIFRMLGTPSEDTWPGVTQLPDYKGSFPKWTRKGLEEIVPNLEPEGRDLLMQLLQYDPSQRITAKTALAHPYFSSPEPSPAARQYVLQRFRH

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T22956-Ab Anti-CDK3 monoclonal antibody
    Target Antigen GM-Tg-g-T22956-Ag CDK3 protein
    ORF Viral Vector pGMLP001003 Human CDK3 Lentivirus plasmid
    ORF Viral Vector pGMLP001860 Human CDK3 Lentivirus plasmid
    ORF Viral Vector pGMLP005194 Human CDK3 Lentivirus plasmid
    ORF Viral Vector vGMLP001003 Human CDK3 Lentivirus particle
    ORF Viral Vector vGMLP001860 Human CDK3 Lentivirus particle
    ORF Viral Vector vGMLP005194 Human CDK3 Lentivirus particle


    Target information

    Target ID GM-T22956
    Target Name CDK3
    Gene ID 1018, 106995622, 101082960, 483323, 618631, 100059230
    Gene Symbol and Synonyms CDK3,TEN1
    Uniprot Accession Q00526
    Uniprot Entry Name CDK3_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000250506
    Target Classification Kinase

    This gene encodes a member of the cyclin-dependent protein kinase family. The protein promotes entry into S phase, in part by activating members of the E2F family of transcription factors. The protein also associates with cyclin C and phosphorylates the retinoblastoma 1 protein to promote exit from G0. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.