Human TCN1/HC/ TC-1 ORF/cDNA clone-Lentivirus plasmid (NM_001062)

Pre-made Human TCN1/HC/ TC-1 Lentiviral expression plasmid for TCN1 lentivirus packaging, TCN1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to TCN1/HC products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP001207 Human TCN1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP001207
Gene Name TCN1
Accession Number NM_001062
Gene ID 6947
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1302 bp
Gene Alias HC, TC-1, TC1, TCI
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGACAGTCACACCAGCTGCCCCTAGTGGGGCTCTTACTGTTTTCTTTTATTCCAAGCCAACTATGCGAGATTTGTGAGGTAAGTGAAGAAAACTACATCCGCCTAAAACCTCTGTTGAATACAATGATCCAGTCAAACTATAACAGGGGAACCAGCGCTGTCAATGTTGTGTTGTCCCTCAAACTTGTTGGAATCCAGATCCAAACCCTGATGCAAAAGATGATCCAACAAATCAAATACAATGTGAAAAGCAGATTGTCAGATGTAAGCTCGGGAGAGCTTGCCTTGATTATACTGGCTTTGGGAGTATGTCGTAACGCTGAGGAAAACTTAATATATGATTACCACCTGATCGACAAGCTAGAAAATAAATTCCAAGCAGAAATTGAAAATATGGAAGCACACAATGGCACTCCCCTGACTAACTACTACCAGCTCAGCCTGGACGTTTTGGCCTTGTGTCTGTTCAATGGGAACTACTCAACCGCCGAAGTTGTCAACCACTTCACTCCTGAAAATAAAAACTATTATTTTGGTAGCCAGTTCTCAGTAGATACTGGTGCAATGGCTGTCCTGGCTCTGACCTGTGTGAAGAAGAGTCTAATAAATGGGCAGATCAAAGCAGATGAAGGCAGTTTAAAGAACATCAGTATTTATACAAAGTCACTGGTAGAAAAGATTCTGTCTGAGAAAAAAGAAAATGGTCTCATTGGAAACACATTTAGCACAGGAGAAGCCATGCAGGCCCTCTTTGTATCATCAGACTATTATAATGAAAATGACTGGAATTGCCAACAAACTCTGAATACAGTGCTCACGGAAATTTCTCAAGGAGCATTCAGCAATCCAAACGCTGCAGCCCAGGTCTTACCTGCCCTGATGGGAAAGACCTTCTTGGATATTAACAAAGACTCTTCTTGCGTCTCTGCTTCAGGTAACTTCAACATCTCCGCTGATGAGCCTATAACTGTGACACCTCCTGACTCACAATCATATATCTCCGTCAATTACTCTGTGAGAATCAATGAAACATATTTCACCAATGTCACTGTGCTAAATGGTTCTGTCTTCCTCAGTGTGATGGAGAAAGCCCAGAAAATGAATGATACTATATTTGGTTTCACAATGGAGGAGCGCTCATGGGGGCCCTATATCACCTGTATTCAGGGCCTATGTGCCAACAATAATGACAGAACCTACTGGGAACTTCTGAGTGGAGGCGAACCACTGAGCCAAGGAGCTGGTAGTTACGTTGTCCGCAATGGAGAAAACTTGGAGGTTCGCTGGAGCAAATACTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1330-Ab Anti-TCO1/ TCN1/ HC functional antibody
    Target Antigen GM-Tg-g-SE1330-Ag TCN1 protein
    ORF Viral Vector pGMLP001207 Human TCN1 Lentivirus plasmid
    ORF Viral Vector vGMLP001207 Human TCN1 Lentivirus particle


    Target information

    Target ID GM-SE1330
    Target Name TCN1
    Gene ID 6947, 698583, 101099656, 612538, 616239, 100058916
    Gene Symbol and Synonyms HC,TC-1,TC1,TCI,TCN1
    Uniprot Accession P20061
    Uniprot Entry Name TCO1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000134827
    Target Classification Not Available

    This gene encodes a member of the vitamin B12-binding protein family. This family of proteins, alternatively referred to as R binders, is expressed in various tissues and secretions. This protein is a major constituent of secondary granules in neutrophils and facilitates the transport of cobalamin into cells. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.