Human CER1/DAND4 ORF/cDNA clone-Lentivirus plasmid (NM_005454)

Cat. No.: pGMLP001228
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CER1/DAND4 Lentiviral expression plasmid for CER1 lentivirus packaging, CER1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to CER1/DAND4 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $501
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001228
Gene Name CER1
Accession Number NM_005454
Gene ID 9350
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 804 bp
Gene Alias DAND4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCATCTCCTCTTATTTCAGCTGCTGGTACTCCTGCCTCTAGGAAAGACCACACGGCACCAGGATGGCCGCCAGAATCAGAGTTCTCTTTCCCCCGTACTCCTGCCAAGGAATCAAAGAGAGCTTCCCACAGGCAACCATGAGGAAGCTGAGGAGAAGCCAGATCTGTTTGTCGCAGTGCCACACCTTGTAGCCACCAGCCCTGCAGGGGAAGGCCAGAGGCAGAGAGAGAAGATGCTGTCCAGATTTGGCAGGTTCTGGAAGAAGCCTGAGAGAGAAATGCATCCATCCAGGGACTCAGATAGTGAGCCCTTCCCACCTGGGACCCAGTCCCTCATCCAGCCGATAGATGGAATGAAAATGGAGAAATCTCCTCTTCGGGAAGAAGCCAAGAAATTCTGGCACCACTTCATGTTCAGAAAAACTCCGGCTTCTCAGGGGGTCATCTTGCCCATCAAAAGCCATGAAGTACATTGGGAGACCTGCAGGACAGTGCCCTTCAGCCAGACTATAACCCACGAAGGCTGTGAAAAAGTAGTTGTTCAGAACAACCTTTGCTTTGGGAAATGCGGGTCTGTTCATTTTCCTGGAGCCGCGCAGCACTCCCATACCTCCTGCTCTCACTGTTTGCCTGCCAAGTTCACCACGATGCACTTGCCACTGAACTGCACTGAACTTTCCTCCGTGATCAAGGTGGTGATGCTGGTGGAGGAGTGCCAGTGCAAGGTGAAGACGGAGCATGAAGATGGACACATCCTACATGCTGGCTCCCAGGATTCCTTTATCCCAGGAGTTTCAGCTTGA
ORF Protein Sequence MHLLLFQLLVLLPLGKTTRHQDGRQNQSSLSPVLLPRNQRELPTGNHEEAEEKPDLFVAVPHLVATSPAGEGQRQREKMLSRFGRFWKKPEREMHPSRDSDSEPFPPGTQSLIQPIDGMKMEKSPLREEAKKFWHHFMFRKTPASQGVILPIKSHEVHWETCRTVPFSQTITHEGCEKVVVQNNLCFGKCGSVHFPGAAQHSHTSCSHCLPAKFTTMHLPLNCTELSSVIKVVMLVEECQCKVKTEHEDGHILHAGSQDSFIPGVSA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0759-Ab Anti-CER1/ DAND4 functional antibody
    Target Antigen GM-Tg-g-SE0759-Ag CER1 protein
    ORF Viral Vector pGMLP001228 Human CER1 Lentivirus plasmid
    ORF Viral Vector vGMLP001228 Human CER1 Lentivirus particle


    Target information

    Target ID GM-SE0759
    Target Name CER1
    Gene ID 9350, 12622, 713924, 500485, 101080489, 611037, 508019, 100062259
    Gene Symbol and Synonyms cer-1,CER1,Cerl,Cerl1,Cerr1,DAND4,RGD1563046
    Uniprot Accession O95813
    Uniprot Entry Name CER1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000147869
    Target Classification Not Available

    This gene encodes a cytokine member of the cysteine knot superfamily, characterized by nine conserved cysteines and a cysteine knot region. The cerberus-related cytokines, together with Dan and DRM/Gremlin, represent a group of bone morphogenetic protein (BMP) antagonists that can bind directly to BMPs and inhibit their activity. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.