Human TIMP1/CLGI/ EPA ORF/cDNA clone-Lentivirus plasmid (NM_003254)

Pre-made Human TIMP1/CLGI/ EPA Lentiviral expression plasmid for TIMP1 lentivirus packaging, TIMP1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to TIMP1/CLGI products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP001347 Human TIMP1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP001347
Gene Name TIMP1
Accession Number NM_003254
Gene ID 7076
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 624 bp
Gene Alias CLGI, EPA, EPO, HCI, TIMP, TIMP-1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCCCCCTTTGAGCCCCTGGCTTCTGGCATCCTGTTGTTGCTGTGGCTGATAGCCCCCAGCAGGGCCTGCACCTGTGTCCCACCCCACCCACAGACGGCCTTCTGCAATTCCGACCTCGTCATCAGGGCCAAGTTCGTGGGGACACCAGAAGTCAACCAGACCACCTTATACCAGCGTTATGAGATCAAGATGACCAAGATGTATAAAGGGTTCCAAGCCTTAGGGGATGCCGCTGACATCCGGTTCGTCTACACCCCCGCCATGGAGAGTGTCTGCGGATACTTCCACAGGTCCCACAACCGCAGCGAGGAGTTTCTCATTGCTGGAAAACTGCAGGATGGACTCTTGCACATCACTACCTGCAGTTTTGTGGCTCCCTGGAACAGCCTGAGCTTAGCTCAGCGCCGGGGCTTCACCAAGACCTACACTGTTGGCTGTGAGGAATGCACAGTGTTTCCCTGTTTATCCATCCCCTGCAAACTGCAGAGTGGCACTCATTGCTTGTGGACGGACCAGCTCCTCCAAGGCTCTGAAAAGGGCTTCCAGTCCCGTCACCTTGCCTGCCTGCCTCGGGAGCCAGGGCTGTGCACCTGGCAGTCCCTGCGGTCCCAGATAGCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0506-Ab Anti-TIMP1/ CLGI/ EPA functional antibody
    Target Antigen GM-Tg-g-SE0506-Ag TIMP1 protein
    ORF Viral Vector pGMLV000257 Human TIMP1 Lentivirus plasmid
    ORF Viral Vector pGMLP001347 Human TIMP1 Lentivirus plasmid
    ORF Viral Vector pGMAP000455 Human TIMP1 Adenovirus plasmid
    ORF Viral Vector pGMAP000469 Human TIMP1 Adenovirus plasmid
    ORF Viral Vector pGMAP000553 Human TIMP1 Adenovirus plasmid
    ORF Viral Vector vGMLV000257 Human TIMP1 Lentivirus particle
    ORF Viral Vector vGMLP001347 Human TIMP1 Lentivirus particle
    ORF Viral Vector vGMAP000455 Human TIMP1 Adenovirus particle
    ORF Viral Vector vGMAP000469 Human TIMP1 Adenovirus particle
    ORF Viral Vector vGMAP000553 Human TIMP1 Adenovirus particle


    Target information

    Target ID GM-SE0506
    Target Name TIMP1
    Gene ID 7076, 21857, 574348, 116510, 101095886, 403816, 282092, 100034220
    Gene Symbol and Synonyms CLGI,EPA,EPO,HCI,TIMP,TIMP-1,TIMP1,TPA-S1
    Uniprot Accession P01033
    Uniprot Entry Name TIMP1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Diagnostics Biomarker
    Disease Dent disease, Vesicoureteral reflux
    Gene Ensembl ENSG00000102265
    Target Classification Not Available

    This gene belongs to the TIMP gene family. The proteins encoded by this gene family are natural inhibitors of the matrix metalloproteinases (MMPs), a group of peptidases involved in degradation of the extracellular matrix. In addition to its inhibitory role against most of the known MMPs, the encoded protein is able to promote cell proliferation in a wide range of cell types, and may also have an anti-apoptotic function. Transcription of this gene is highly inducible in response to many cytokines and hormones. In addition, the expression from some but not all inactive X chromosomes suggests that this gene inactivation is polymorphic in human females. This gene is located within intron 6 of the synapsin I gene and is transcribed in the opposite direction. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.