Human TIMP1/CLGI/ EPA ORF/cDNA clone-Lentivirus plasmid (NM_003254)
Pre-made Human TIMP1/CLGI/ EPA Lentiviral expression plasmid for TIMP1 lentivirus packaging, TIMP1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to TIMP1/CLGI products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP001347 | Human TIMP1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP001347 |
Gene Name | TIMP1 |
Accession Number | NM_003254 |
Gene ID | 7076 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 624 bp |
Gene Alias | CLGI, EPA, EPO, HCI, TIMP, TIMP-1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCCCCCTTTGAGCCCCTGGCTTCTGGCATCCTGTTGTTGCTGTGGCTGATAGCCCCCAGCAGGGCCTGCACCTGTGTCCCACCCCACCCACAGACGGCCTTCTGCAATTCCGACCTCGTCATCAGGGCCAAGTTCGTGGGGACACCAGAAGTCAACCAGACCACCTTATACCAGCGTTATGAGATCAAGATGACCAAGATGTATAAAGGGTTCCAAGCCTTAGGGGATGCCGCTGACATCCGGTTCGTCTACACCCCCGCCATGGAGAGTGTCTGCGGATACTTCCACAGGTCCCACAACCGCAGCGAGGAGTTTCTCATTGCTGGAAAACTGCAGGATGGACTCTTGCACATCACTACCTGCAGTTTTGTGGCTCCCTGGAACAGCCTGAGCTTAGCTCAGCGCCGGGGCTTCACCAAGACCTACACTGTTGGCTGTGAGGAATGCACAGTGTTTCCCTGTTTATCCATCCCCTGCAAACTGCAGAGTGGCACTCATTGCTTGTGGACGGACCAGCTCCTCCAAGGCTCTGAAAAGGGCTTCCAGTCCCGTCACCTTGCCTGCCTGCCTCGGGAGCCAGGGCTGTGCACCTGGCAGTCCCTGCGGTCCCAGATAGCCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0506-Ab | Anti-TIMP1/ CLGI/ EPA functional antibody |
Target Antigen | GM-Tg-g-SE0506-Ag | TIMP1 protein |
ORF Viral Vector | pGMLV000257 | Human TIMP1 Lentivirus plasmid |
ORF Viral Vector | pGMLP001347 | Human TIMP1 Lentivirus plasmid |
ORF Viral Vector | pGMAP000455 | Human TIMP1 Adenovirus plasmid |
ORF Viral Vector | pGMAP000469 | Human TIMP1 Adenovirus plasmid |
ORF Viral Vector | pGMAP000553 | Human TIMP1 Adenovirus plasmid |
ORF Viral Vector | vGMLV000257 | Human TIMP1 Lentivirus particle |
ORF Viral Vector | vGMLP001347 | Human TIMP1 Lentivirus particle |
ORF Viral Vector | vGMAP000455 | Human TIMP1 Adenovirus particle |
ORF Viral Vector | vGMAP000469 | Human TIMP1 Adenovirus particle |
ORF Viral Vector | vGMAP000553 | Human TIMP1 Adenovirus particle |
Target information
Target ID | GM-SE0506 |
Target Name | TIMP1 |
Gene ID | 7076, 21857, 574348, 116510, 101095886, 403816, 282092, 100034220 |
Gene Symbol and Synonyms | CLGI,EPA,EPO,HCI,TIMP,TIMP-1,TIMP1,TPA-S1 |
Uniprot Accession | P01033 |
Uniprot Entry Name | TIMP1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Diagnostics Biomarker |
Disease | Dent disease, Vesicoureteral reflux |
Gene Ensembl | ENSG00000102265 |
Target Classification | Not Available |
This gene belongs to the TIMP gene family. The proteins encoded by this gene family are natural inhibitors of the matrix metalloproteinases (MMPs), a group of peptidases involved in degradation of the extracellular matrix. In addition to its inhibitory role against most of the known MMPs, the encoded protein is able to promote cell proliferation in a wide range of cell types, and may also have an anti-apoptotic function. Transcription of this gene is highly inducible in response to many cytokines and hormones. In addition, the expression from some but not all inactive X chromosomes suggests that this gene inactivation is polymorphic in human females. This gene is located within intron 6 of the synapsin I gene and is transcribed in the opposite direction. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.