Human ACP2/LAP ORF/cDNA clone-Lentivirus plasmid (NM_001610)
Cat. No.: pGMLP001446
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human ACP2/LAP Lentiviral expression plasmid for ACP2 lentivirus packaging, ACP2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
ACP2/LAP products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP001446 |
Gene Name | ACP2 |
Accession Number | NM_001610 |
Gene ID | 53 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1272 bp |
Gene Alias | LAP |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCGGGCAAGCGGTCCGGCTGGAGCCGGGCGGCTCTCCTCCAGCTCCTTCTCGGCGTGAACCTGGTGGTGATGCCGCCCACCCGGGCCCGGAGTCTGCGCTTCGTTACCTTGCTGTACCGCCATGGAGACCGTTCACCAGTGAAGACATATCCCAAGGACCCCTATCAGGAAGAAGAATGGCCCCAGGGGTTTGGTCAGTTAACCAAGGAGGGGATGCTACAGCACTGGGAACTGGGCCAGGCCCTGCGGCAGCGCTATCACGGCTTCCTAAACACCTCTTATCACCGGCAAGAGGTTTATGTGCGAAGCACAGACTTTGACCGGACTCTCATGAGTGCTGAGGCCAACCTGGCTGGACTCTTCCCTCCCAACGGGATGCAGCGCTTCAACCCGAACATCTCGTGGCAGCCTATTCCTGTGCACACTGTGCCCATCACTGAGGACAGGCTGCTGAAGTTCCCGTTGGGCCCATGTCCCCGTTATGAGCAGCTGCAGAACGAGACCCGGCAGACACCAGAGTATCAGAATGAGAGTTCTCGGAATGCACAATTTCTGGACATGGTGGCCAACGAGACAGGGCTTACAGACCTGACACTGGAGACCGTCTGGAATGTCTATGACACACTCTTCTGTGAGCAAACGCACGGGCTGCGCCTGCCGCCCTGGGCCTCACCCCAAACCATGCAGCGTCTCAGCCGGCTAAAGGACTTCAGCTTCCGCTTCCTCTTCGGAATCTACCAGCAGGCGGAGAAGGCCCGGCTTCAGGGGGGAGTCCTGCTGGCTCAGATAAGGAAGAACCTGACCCTAATGGCGACCACCTCCCAGCTCCCCAAGCTGCTGGTTTACTCTGCGCACGACACTACCCTGGTTGCCCTGCAAATGGCACTGGATGTCTACAATGGTGAACAAGCCCCCTACGCCTCCTGCCACATATTTGAACTGTACCAGGAAGATTCTGGGAATTTCTCAGTGGAGATGTACTTTCGGAACGAGAGTGACAAGGCCCCCTGGCCGCTCAGCCTGCCTGGCTGCCCTCACCGCTGCCCACTGCAGGACTTCCTTCGCCTCACAGAGCCCGTCGTGCCCAAGGATTGGCAGCAGGAGTGCCAGCTGGCAAGCGGTCCTGCAGACACAGAGGTGATTGTGGCCTTGGCTGTATGTGGCTCCATCCTCTTCCTCCTCATAGTGCTGCTCCTCACCGTCCTCTTCCGGATGCAGGCCCAGCCTCCTGGCTACCGCCACGTCGCAGATGGGGAGGACCACGCCTGA |
ORF Protein Sequence | MAGKRSGWSRAALLQLLLGVNLVVMPPTRARSLRFVTLLYRHGDRSPVKTYPKDPYQEEEWPQGFGQLTKEGMLQHWELGQALRQRYHGFLNTSYHRQEVYVRSTDFDRTLMSAEANLAGLFPPNGMQRFNPNISWQPIPVHTVPITEDRLLKFPLGPCPRYEQLQNETRQTPEYQNESSRNAQFLDMVANETGLTDLTLETVWNVYDTLFCEQTHGLRLPPWASPQTMQRLSRLKDFSFRFLFGIYQQAEKARLQGGVLLAQIRKNLTLMATTSQLPKLLVYSAHDTTLVALQMALDVYNGEQAPYASCHIFELYQEDSGNFSVEMYFRNESDKAPWPLSLPGCPHRCPLQDFLRLTEPVVPKDWQQECQLASGPADTEVIVALAVCGSILFLLIVLLLTVLFRMQAQPPGYRHVADGEDHA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0007-Ab | Anti-PPAL/ ACP2/ LAP functional antibody |
Target Antigen | GM-Tg-g-SE0007-Ag | ACP2 protein |
ORF Viral Vector | pGMLP001446 | Human ACP2 Lentivirus plasmid |
ORF Viral Vector | vGMLP001446 | Human ACP2 Lentivirus particle |
Target information
Target ID | GM-SE0007 |
Target Name | ACP2 |
Gene ID | 53, 11432, 713744, 24162, 101092463, 475983, 535407, 100057910 |
Gene Symbol and Synonyms | Acp-2,ACP2,LAP |
Uniprot Accession | P11117 |
Uniprot Entry Name | PPAL_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000134575 |
Target Classification | Not Available |
The protein encoded by this gene belongs to the histidine acid phosphatase family, which hydrolyze orthophosphoric monoesters to alcohol and phosphate. This protein is localized to the lysosomal membrane, and is chemically and genetically distinct from the red cell acid phosphatase. Mice lacking this gene showed multiple defects, including bone structure alterations, lysosomal storage defects, and an increased tendency towards seizures. An enzymatically-inactive allele of this gene in mice showed severe growth retardation, hair-follicle abnormalities, and an ataxia-like phenotype. Alternatively spliced transcript variants have been found for this gene. A C-terminally extended isoform is also predicted to be produced by the use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism. [provided by RefSeq, Oct 2017]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.