Human ACP2/LAP ORF/cDNA clone-Lentivirus plasmid (NM_001610)

Cat. No.: pGMLP001446
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human ACP2/LAP Lentiviral expression plasmid for ACP2 lentivirus packaging, ACP2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to ACP2/LAP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $656.16
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001446
Gene Name ACP2
Accession Number NM_001610
Gene ID 53
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1272 bp
Gene Alias LAP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGGGCAAGCGGTCCGGCTGGAGCCGGGCGGCTCTCCTCCAGCTCCTTCTCGGCGTGAACCTGGTGGTGATGCCGCCCACCCGGGCCCGGAGTCTGCGCTTCGTTACCTTGCTGTACCGCCATGGAGACCGTTCACCAGTGAAGACATATCCCAAGGACCCCTATCAGGAAGAAGAATGGCCCCAGGGGTTTGGTCAGTTAACCAAGGAGGGGATGCTACAGCACTGGGAACTGGGCCAGGCCCTGCGGCAGCGCTATCACGGCTTCCTAAACACCTCTTATCACCGGCAAGAGGTTTATGTGCGAAGCACAGACTTTGACCGGACTCTCATGAGTGCTGAGGCCAACCTGGCTGGACTCTTCCCTCCCAACGGGATGCAGCGCTTCAACCCGAACATCTCGTGGCAGCCTATTCCTGTGCACACTGTGCCCATCACTGAGGACAGGCTGCTGAAGTTCCCGTTGGGCCCATGTCCCCGTTATGAGCAGCTGCAGAACGAGACCCGGCAGACACCAGAGTATCAGAATGAGAGTTCTCGGAATGCACAATTTCTGGACATGGTGGCCAACGAGACAGGGCTTACAGACCTGACACTGGAGACCGTCTGGAATGTCTATGACACACTCTTCTGTGAGCAAACGCACGGGCTGCGCCTGCCGCCCTGGGCCTCACCCCAAACCATGCAGCGTCTCAGCCGGCTAAAGGACTTCAGCTTCCGCTTCCTCTTCGGAATCTACCAGCAGGCGGAGAAGGCCCGGCTTCAGGGGGGAGTCCTGCTGGCTCAGATAAGGAAGAACCTGACCCTAATGGCGACCACCTCCCAGCTCCCCAAGCTGCTGGTTTACTCTGCGCACGACACTACCCTGGTTGCCCTGCAAATGGCACTGGATGTCTACAATGGTGAACAAGCCCCCTACGCCTCCTGCCACATATTTGAACTGTACCAGGAAGATTCTGGGAATTTCTCAGTGGAGATGTACTTTCGGAACGAGAGTGACAAGGCCCCCTGGCCGCTCAGCCTGCCTGGCTGCCCTCACCGCTGCCCACTGCAGGACTTCCTTCGCCTCACAGAGCCCGTCGTGCCCAAGGATTGGCAGCAGGAGTGCCAGCTGGCAAGCGGTCCTGCAGACACAGAGGTGATTGTGGCCTTGGCTGTATGTGGCTCCATCCTCTTCCTCCTCATAGTGCTGCTCCTCACCGTCCTCTTCCGGATGCAGGCCCAGCCTCCTGGCTACCGCCACGTCGCAGATGGGGAGGACCACGCCTGA
ORF Protein Sequence MAGKRSGWSRAALLQLLLGVNLVVMPPTRARSLRFVTLLYRHGDRSPVKTYPKDPYQEEEWPQGFGQLTKEGMLQHWELGQALRQRYHGFLNTSYHRQEVYVRSTDFDRTLMSAEANLAGLFPPNGMQRFNPNISWQPIPVHTVPITEDRLLKFPLGPCPRYEQLQNETRQTPEYQNESSRNAQFLDMVANETGLTDLTLETVWNVYDTLFCEQTHGLRLPPWASPQTMQRLSRLKDFSFRFLFGIYQQAEKARLQGGVLLAQIRKNLTLMATTSQLPKLLVYSAHDTTLVALQMALDVYNGEQAPYASCHIFELYQEDSGNFSVEMYFRNESDKAPWPLSLPGCPHRCPLQDFLRLTEPVVPKDWQQECQLASGPADTEVIVALAVCGSILFLLIVLLLTVLFRMQAQPPGYRHVADGEDHA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0007-Ab Anti-PPAL/ ACP2/ LAP functional antibody
    Target Antigen GM-Tg-g-SE0007-Ag ACP2 protein
    ORF Viral Vector pGMLP001446 Human ACP2 Lentivirus plasmid
    ORF Viral Vector vGMLP001446 Human ACP2 Lentivirus particle


    Target information

    Target ID GM-SE0007
    Target Name ACP2
    Gene ID 53, 11432, 713744, 24162, 101092463, 475983, 535407, 100057910
    Gene Symbol and Synonyms Acp-2,ACP2,LAP
    Uniprot Accession P11117
    Uniprot Entry Name PPAL_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000134575
    Target Classification Not Available

    The protein encoded by this gene belongs to the histidine acid phosphatase family, which hydrolyze orthophosphoric monoesters to alcohol and phosphate. This protein is localized to the lysosomal membrane, and is chemically and genetically distinct from the red cell acid phosphatase. Mice lacking this gene showed multiple defects, including bone structure alterations, lysosomal storage defects, and an increased tendency towards seizures. An enzymatically-inactive allele of this gene in mice showed severe growth retardation, hair-follicle abnormalities, and an ataxia-like phenotype. Alternatively spliced transcript variants have been found for this gene. A C-terminally extended isoform is also predicted to be produced by the use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism. [provided by RefSeq, Oct 2017]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.