Human HNRNPK/AUKS/CSBP ORF/cDNA clone-Lentivirus plasmid (NM_031262)

Cat. No.: pGMLP001524
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human HNRNPK/AUKS/CSBP Lentiviral expression plasmid for HNRNPK lentivirus packaging, HNRNPK lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to HNRNPK/AUKS products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $689.76
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001524
Gene Name HNRNPK
Accession Number NM_031262
Gene ID 3190
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1392 bp
Gene Alias AUKS,CSBP,HNRPK,TUNP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAAACTGAACAGCCAGAAGAAACCTTCCCTAACACTGAAACCAATGGTGAATTTGGTAAACGCCCTGCAGAAGATATGGAAGAGGAACAAGCATTTAAAAGATCTAGAAACACTGATGAGATGGTTGAATTACGCATTCTGCTTCAGAGCAAGAATGCTGGGGCAGTGATTGGAAAAGGAGGCAAGAATATTAAGGCTCTCCGTACAGACTACAATGCCAGTGTTTCAGTCCCAGACAGCAGTGGCCCCGAGCGCATATTGAGTATCAGTGCTGATATTGAAACAATTGGAGAAATTCTGAAGAAAATCATCCCTACCTTGGAAGAGGGCCTGCAGTTGCCATCACCCACTGCAACCAGCCAGCTCCCGCTCGAATCTGATGCTGTGGAATGCTTAAATTACCAACACTATAAAGGAAGTGACTTTGACTGCGAGTTGAGGCTGTTGATTCATCAGAGTCTAGCAGGAGGAATTATTGGGGTCAAAGGTGCTAAAATCAAAGAACTTCGAGAGAACACTCAAACCACCATCAAGCTTTTCCAGGAATGCTGTCCTCATTCCACTGACAGAGTTGTTCTTATTGGAGGAAAACCCGATAGGGTTGTAGAGTGCATAAAGATCATCCTTGATCTTATATCTGAGTCTCCCATCAAAGGACGTGCACAGCCTTATGATCCCAATTTTTACGATGAAACCTATGATTATGGTGGTTTTACAATGATGTTTGATGACCGTCGCGGACGCCCAGTGGGATTTCCCATGCGGGGAAGAGGTGGTTTTGACAGAATGCCTCCTGGTCGGGGTGGGCGTCCCATGCCTCCATCTAGAAGAGATTATGATGATATGAGCCCTCGTCGAGGACCACCTCCCCCTCCTCCCGGACGAGGCGGCCGGGGTGGTAGCAGAGCTCGGAATCTTCCTCTTCCTCCACCACCACCACCTAGAGGGGGAGACCTCATGGCCTATGACAGAAGAGGGAGACCTGGAGACCGTTACGACGGCATGGTTGGTTTCAGTGCTGATGAAACTTGGGACTCTGCAATAGATACATGGAGCCCATCAGAATGGCAGATGGCTTATGAACCACAGGGTGGCTCCGGATATGATTATTCCTATGCAGGGGGTCGTGGCTCATATGGTGATCTTGGTGGACCTATTATTACTACACAAGTAACTATTCCCAAAGATTTGGCTGGATCTATTATTGGCAAAGGTGGTCAGCGGATTAAACAAATCCGTCATGAGTCGGGAGCTTCGATCAAAATTGATGAGCCTTTAGAAGGATCCGAAGATCGGATCATTACCATTACAGGAACACAGGACCAGATACAGAATGCACAGTATTTGCTGCAGAACAGTGTGAAGCAGTATTCTGGAAAGTTTTTCTAA
ORF Protein Sequence METEQPEETFPNTETNGEFGKRPAEDMEEEQAFKRSRNTDEMVELRILLQSKNAGAVIGKGGKNIKALRTDYNASVSVPDSSGPERILSISADIETIGEILKKIIPTLEEGLQLPSPTATSQLPLESDAVECLNYQHYKGSDFDCELRLLIHQSLAGGIIGVKGAKIKELRENTQTTIKLFQECCPHSTDRVVLIGGKPDRVVECIKIILDLISESPIKGRAQPYDPNFYDETYDYGGFTMMFDDRRGRPVGFPMRGRGGFDRMPPGRGGRPMPPSRRDYDDMSPRRGPPPPPPGRGGRGGSRARNLPLPPPPPPRGGDLMAYDRRGRPGDRYDGMVGFSADETWDSAIDTWSPSEWQMAYEPQGGSGYDYSYAGGRGSYGDLGGPIITTQVTIPKDLAGSIIGKGGQRIKQIRHESGASIKIDEPLEGSEDRIITITGTQDQIQNAQYLLQNSVKQYSGKFF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0974-Ab Anti-HNRNPK monoclonal antibody
    Target Antigen GM-Tg-g-IP0974-Ag HNRNPK protein
    ORF Viral Vector pGMLP001524 Human HNRNPK Lentivirus plasmid
    ORF Viral Vector vGMLP001524 Human HNRNPK Lentivirus particle


    Target information

    Target ID GM-IP0974
    Target Name HNRNPK
    Gene ID 3190, 15387, 709112, 117282, 101099911, 100855638, 528135, 100052735
    Gene Symbol and Synonyms AUKS,CSBP,HNRNPK,HNRPK,KBBP,NOVA,TUNP
    Uniprot Accession P61978
    Uniprot Entry Name HNRPK_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000165119
    Target Classification Not Available

    This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene is located in the nucleoplasm and has three repeats of KH domains that binds to RNAs. It is distinct among other hnRNP proteins in its binding preference; it binds tenaciously to poly(C). This protein is also thought to have a role during cell cycle progession. Several alternatively spliced transcript variants have been described for this gene, however, not all of them are fully characterized. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.