Human RARG/NR1B3/ RARC ORF/cDNA clone-Lentivirus plasmid (NM_000966)
Pre-made Human RARG/NR1B3/ RARC Lentiviral expression plasmid for RARG lentivirus packaging, RARG lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to RARG/NR1B3 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP001553 | Human RARG Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP001553 |
Gene Name | RARG |
Accession Number | NM_000966 |
Gene ID | 5916 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1365 bp |
Gene Alias | NR1B3, RARC |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCCACCAATAAGGAGCGACTCTTTGCGGCTGGTGCCCTGGGGCCTGGATCTGGCTACCCAGGGGCAGGTTTCCCCTTCGCCTTCCCAGGGGCACTCAGGGGGTCTCCGCCTTTCGAGATGCTGAGCCCTAGCTTCCGGGGCCTGGGCCAGCCTGACCTCCCCAAGGAGATGGCCTCTCTGTCGGTGGAGACACAGAGCACCAGCTCAGAGGAGATGGTGCCCAGCTCGCCCTCGCCCCCTCCGCCTCCTCGGGTCTACAAGCCATGCTTCGTGTGCAATGACAAGTCCTCTGGCTACCACTATGGGGTCAGCTCTTGTGAAGGCTGCAAGGGCTTCTTTCGCCGAAGCATCCAGAAGAACATGGTGTACACGTGTCACCGCGACAAAAACTGTATCATCAACAAGGTGACCAGGAATCGCTGCCAGTACTGCCGGCTACAGAAGTGCTTCGAAGTGGGCATGTCCAAGGAAGCTGTGCGAAATGACCGGAACAAGAAGAAGAAAGAGGTGAAGGAAGAAGGGTCACCTGACAGCTATGAGCTGAGCCCTCAGTTAGAAGAGCTCATCACCAAGGTCAGCAAAGCCCATCAGGAGACTTTCCCCTCGCTCTGCCAGCTGGGCAAGTATACCACGAACTCCAGTGCAGACCACCGCGTGCAGCTGGATCTGGGGCTGTGGGACAAGTTCAGTGAGCTGGCTACCAAGTGCATCATCAAGATCGTGGAGTTTGCCAAGCGGTTGCCTGGCTTTACAGGGCTCAGCATTGCTGACCAGATCACTCTGCTCAAAGCTGCCTGCCTAGATATCCTGATGCTGCGTATCTGCACAAGGTACACCCCAGAGCAGGACACCATGACCTTCTCCGACGGGCTGACCCTGAACCGGACCCAGATGCACAATGCCGGCTTCGGGCCCCTCACAGACCTTGTCTTTGCCTTTGCTGGGCAGCTCCTGCCCCTGGAGATGGATGACACCGAGACAGGGCTGCTCAGCGCCATCTGCCTCATCTGCGGAGACCGCATGGACCTGGAGGAGCCCGAAAAAGTGGACAAGCTGCAGGAGCCACTGCTGGAAGCCCTGAGGCTGTACGCCCGGCGCCGGCGGCCCAGCCAGCCCTACATGTTCCCAAGGATGCTAATGAAAATCACCGACCTCCGGGGCATCAGCACTAAGGGAGCTGAAAGGGCCATTACTCTGAAGATGGAGATTCCAGGCCCGATGCCTCCCTTAATCCGAGAGATGCTGGAGAACCCTGAAATGTTTGAGGATGACTCCTCGCAGCCTGGTCCCCACCCCAATGCCTCTAGCGAGGATGAGGTTCCTGGGGGCCAGGGCAAAGGGGGCCTGAAGTCCCCAGCCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T82146-Ab | Anti-RARG monoclonal antibody |
Target Antigen | GM-Tg-g-T82146-Ag | RARG protein |
ORF Viral Vector | pGMLP001553 | Human RARG Lentivirus plasmid |
ORF Viral Vector | vGMLP001553 | Human RARG Lentivirus particle |
Target information
Target ID | GM-T82146 |
Target Name | RARG |
Gene ID | 5916, 19411, 699532, 685072, 101083275, 486508, 540425, 100062026 |
Gene Symbol and Synonyms | NR1B3,RAR-gamma,RARC,RARD,RARG,RARgamma,RARgamma2 |
Uniprot Accession | P13631 |
Uniprot Entry Name | RARG_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000172819 |
Target Classification | Not Available |
This gene encodes a retinoic acid receptor that belongs to the nuclear hormone receptor family. Retinoic acid receptors (RARs) act as ligand-dependent transcriptional regulators. When bound to ligands, RARs activate transcription by binding as heterodimers to the retinoic acid response elements (RARE) found in the promoter regions of the target genes. In their unbound form, RARs repress transcription of their target genes. RARs are involved in various biological processes, including limb bud development, skeletal growth, and matrix homeostasis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.