Human CHST6/MCDC1 ORF/cDNA clone-Lentivirus plasmid (NM_021615)

Cat. No.: pGMLP001618
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CHST6/MCDC1 Lentiviral expression plasmid for CHST6 lentivirus packaging, CHST6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to CHST6/MCDC1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $632.64
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001618
Gene Name CHST6
Accession Number NM_021615
Gene ID 4166
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1188 bp
Gene Alias MCDC1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTGGCTGCCGCGCGTCTCCAGCACAGCAGTGACCGCGCTCCTCCTGGCGCAGACCTTCCTCCTCCTCTTTCTGGTTTCCCGGCCAGGGCCCTCGTCCCCAGCAGGCGGCGAGGCGCGCGTGCATGTGCTGGTGCTGTCCTCGTGGCGCTCGGGCTCGTCCTTCGTGGGCCAACTCTTCAACCAGCACCCCGACGTCTTCTACCTAATGGAGCCCGCGTGGCACGTGTGGACCACCCTGTCGCAGGGCAGCGCCGCAACGCTGCACATGGCTGTGCGCGACCTGGTGCGCTCCGTCTTCCTGTGCGACATGGACGTGTTTGATGCCTATCTGCCTTGGCGCCGCAACCTGTCCGACCTCTTCCAGTGGGCCGTGAGCCGTGCACTGTGCTCGCCACCCGCCTGCAGTGCCTTTCCCCGAGGCGCCATCAGCAGCGAGGCCGTGTGCAAGCCACTGTGCGCGCGGCAGTCCTTCACCCTGGCCCGGGAGGCCTGCCGCTCCTACAGCCACGTGGTGCTCAAGGAGGTGCGCTTCTTCAACCTGCAGGTGCTCTACCCGCTGCTCAGCGACCCCGCGCTCAACCTACGCATCGTGCACCTGGTGCGCGACCCGCGGGCCGTGCTGCGCTCCCGGGAGCAGACAGCCAAGGCTCTGGCGCGTGACAACGGCATCGTGCTGGGCACCAACGGCACGTGGGTGGAGGCCGACCCCGGCCTGCGCGTGGTGCGCGAGGTGTGCCGTAGCCACGTACGCATCGCCGAGGCCGCCACACTCAAGCCGCCACCCTTTCTGCGCGGCCGCTACCGCCTGGTGCGCTTCGAGGACCTGGCGCGGGAGCCGCTGGCAGAAATCCGTGCGCTCTACGCCTTCACTGGGCTCAGTCTCACGCCACAGCTCGAGGCCTGGATCCATAACATCACCCACGGATCTGGACCTGGTGCGCGCCGCGAAGCCTTCAAGACTTCGTCCAGGAATGCGCTCAACGTCTCCCAGGCCTGGCGCCATGCGCTGCCCTTTGCCAAGATCCGCCGCGTGCAGGAACTGTGCGCTGGTGCGCTGCAGCTGCTGGGCTACCGGCCTGTGTACTCTGAGGACGAGCAGCGCAACCTCGCCCTTGATCTGGTGCTGCCACGAGGCCTGAACGGCTTCACTTGGGCATCATCCACCGCCTCGCACCCCCGAAATTAG
ORF Protein Sequence MWLPRVSSTAVTALLLAQTFLLLFLVSRPGPSSPAGGEARVHVLVLSSWRSGSSFVGQLFNQHPDVFYLMEPAWHVWTTLSQGSAATLHMAVRDLVRSVFLCDMDVFDAYLPWRRNLSDLFQWAVSRALCSPPACSAFPRGAISSEAVCKPLCARQSFTLAREACRSYSHVVLKEVRFFNLQVLYPLLSDPALNLRIVHLVRDPRAVLRSREQTAKALARDNGIVLGTNGTWVEADPGLRVVREVCRSHVRIAEAATLKPPPFLRGRYRLVRFEDLAREPLAEIRALYAFTGLSLTPQLEAWIHNITHGSGPGARREAFKTSSRNALNVSQAWRHALPFAKIRRVQELCAGALQLLGYRPVYSEDEQRNLALDLVLPRGLNGFTWASSTASHPRN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0086-Ab Anti-CHST6/ MCDC1 functional antibody
    Target Antigen GM-Tg-g-SE0086-Ag CHST6 protein
    ORF Viral Vector pGMLP001618 Human CHST6 Lentivirus plasmid
    ORF Viral Vector vGMLP001618 Human CHST6 Lentivirus particle


    Target information

    Target ID GM-SE0086
    Target Name CHST6
    Gene ID 4166, 711570, 100068994
    Gene Symbol and Synonyms C-GlcNAc6ST,CHST6,glcNAc6ST-5,gn6st-5,GST4-beta,hCGn6ST,MCDC1
    Uniprot Accession Q9GZX3
    Uniprot Entry Name CHST6_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000183196
    Target Classification Not Available

    The protein encoded by this gene is an enzyme that catalyzes the transfer of a sulfate group to the GlcNAc residues of keratan. Keratan sulfate helps maintain corneal transparency. Defects in this gene are a cause of macular corneal dystrophy (MCD). [provided by RefSeq, Jan 2010]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.