Human GAPDHS/GAPD2/GAPDH-2 ORF/cDNA clone-Lentivirus plasmid (NM_014364)

Cat. No.: pGMLP001649
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human GAPDHS/GAPD2/GAPDH-2 Lentiviral expression plasmid for GAPDHS lentivirus packaging, GAPDHS lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to GAPDHS/GAPD2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $643.56
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001649
Gene Name GAPDHS
Accession Number NM_014364
Gene ID 26330
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1227 bp
Gene Alias GAPD2,GAPDH-2,GAPDS,HEL-S-278,HSD-35
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCGAAGCGCGACATCGTCCTCACCAATGTCACCGTTGTCCAGTTGCTGCGACAGCCGTGCCCGGTGACCAGAGCACCGCCCCCACCTGAGCCTAAGGCTGAAGTAGAGCCCCAGCCACAACCAGAGCCCACACCAGTCAGGGAGGAAATAAAGCCACCACCGCCACCACTGCCTCCTCACCCCGCTACTCCTCCTCCTAAGATGGTGTCTGTGGCCCGGGAGCTGACTGTGGGCATCAATGGATTTGGACGCATCGGTCGCCTGGTCCTGCGCGCCTGCATGGAGAAGGGTGTTAAGGTGGTGGCTGTGAATGATCCATTCATTGACCCGGAATACATGGTGTACATGTTTAAGTATGACTCCACCCACGGCCGATACAAGGGAAGTGTGGAATTCAGGAATGGACAACTGGTCGTGGACAACCATGAGATCTCTGTCTACCAGTGCAAAGAGCCCAAACAGATCCCCTGGAGGGCTGTCGGGAGCCCCTACGTGGTGGAGTCCACAGGCGTGTACCTCTCCATACAGGCAGCTTCGGACCACATCTCTGCAGGTGCTCAACGTGTGGTCATCTCCGCGCCCTCACCGGATGCACCAATGTTCGTCATGGGTGTCAATGAAAATGACTATAACCCTGGCTCCATGAACATTGTGAGCAACGCGTCCTGCACCACCAACTGTTTGGCTCCCCTCGCCAAAGTCATCCACGAGCGATTTGGGATCGTGGAAGGGTTGATGACCACAGTCCATTCCTACACGGCCACCCAGAAGACAGTGGACGGGCCATCAAGGAAGGCCTGGCGAGATGGGCGGGGTGCCCACCAGAACATCATCCCAGCCTCCACTGGGGCTGCGAAAGCTGTGACCAAAGTCATCCCAGAGCTCAAAGGGAAGCTGACAGGGATGGCGTTCCGGGTACCAACCCCGGATGTGTCTGTCGTGGACCTGACCTGCCGCCTCGCCCAGCCTGCCCCCTACTCAGCCATCAAGGAGGCTGTAAAAGCAGCAGCCAAGGGGCCCATGGCTGGCATCCTTGCCTACACCGAGGATGAGGTCGTCTCTACGGACTTCCTCGGTGATACCCACTCGTCCATCTTCGATGCTAAGGCCGGCATTGCGCTCAATGACAATTTCGTGAAGCTCATTTCATGGTACGACAACGAATATGGCTACAGTCACCGGGTGGTCGACCTCCTCCGCTACATGTTCAGCCGAGACAAGTGA
ORF Protein Sequence MSKRDIVLTNVTVVQLLRQPCPVTRAPPPPEPKAEVEPQPQPEPTPVREEIKPPPPPLPPHPATPPPKMVSVARELTVGINGFGRIGRLVLRACMEKGVKVVAVNDPFIDPEYMVYMFKYDSTHGRYKGSVEFRNGQLVVDNHEISVYQCKEPKQIPWRAVGSPYVVESTGVYLSIQAASDHISAGAQRVVISAPSPDAPMFVMGVNENDYNPGSMNIVSNASCTTNCLAPLAKVIHERFGIVEGLMTTVHSYTATQKTVDGPSRKAWRDGRGAHQNIIPASTGAAKAVTKVIPELKGKLTGMAFRVPTPDVSVVDLTCRLAQPAPYSAIKEAVKAAAKGPMAGILAYTEDEVVSTDFLGDTHSSIFDAKAGIALNDNFVKLISWYDNEYGYSHRVVDLLRYMFSRDK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0889-Ab Anti-GAPDHS monoclonal antibody
    Target Antigen GM-Tg-g-IP0889-Ag GAPDHS protein
    ORF Viral Vector pGMLP001649 Human GAPDHS Lentivirus plasmid
    ORF Viral Vector vGMLP001649 Human GAPDHS Lentivirus particle


    Target information

    Target ID GM-IP0889
    Target Name GAPDHS
    Gene ID 26330, 14447, 709485, 66020, 101099515, 476483, 532231, 100051032
    Gene Symbol and Synonyms Gapd-s,GAPD2,GAPDH-2,GAPDHS,GAPDS,HEL-S-278,HSD-35
    Uniprot Accession O14556
    Uniprot Entry Name G3PT_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000105679
    Target Classification Not Available

    This gene encodes a protein belonging to the glyceraldehyde-3-phosphate dehydrogenase family of enzymes that play an important role in carbohydrate metabolism. Like its somatic cell counterpart, this sperm-specific enzyme functions in a nicotinamide adenine dinucleotide-dependent manner to remove hydrogen and add phosphate to glyceraldehyde 3-phosphate to form 1,3-diphosphoglycerate. During spermiogenesis, this enzyme may play an important role in regulating the switch between different energy-producing pathways, and it is required for sperm motility and male fertility. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.