Human IDUA/IDA/ MPS1 ORF/cDNA clone-Lentivirus plasmid (NM_000203)

Pre-made Human IDUA/IDA/ MPS1 Lentiviral expression plasmid for IDUA lentivirus packaging, IDUA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to IDUA/IDA products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP001664 Human IDUA Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP001664
Gene Name IDUA
Accession Number NM_000203
Gene ID 3425
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1962 bp
Gene Alias IDA, MPS1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCGTCCCCTGCGCCCCCGCGCCGCGCTGCTGGCGCTCCTGGCCTCGCTCCTGGCCGCGCCCCCGGTGGCCCCGGCCGAGGCCCCGCACCTGGTGCATGTGGACGCGGCCCGCGCGCTGTGGCCCCTGCGGCGCTTCTGGAGGAGCACAGGCTTCTGCCCCCCGCTGCCACACAGCCAGGCTGACCAGTACGTCCTCAGCTGGGACCAGCAGCTCAACCTCGCCTATGTGGGCGCCGTCCCTCACCGCGGCATCAAGCAGGTCCGGACCCACTGGCTGCTGGAGCTTGTCACCACCAGGGGGTCCACTGGACGGGGCCTGAGCTACAACTTCACCCACCTGGACGGGTACCTGGACCTTCTCAGGGAGAACCAGCTCCTCCCAGGGTTTGAGCTGATGGGCAGCGCCTCGGGCCACTTCACTGACTTTGAGGACAAGCAGCAGGTGTTTGAGTGGAAGGACTTGGTCTCCAGCCTGGCCAGGAGATACATCGGTAGGTACGGACTGGCGCATGTTTCCAAGTGGAACTTCGAGACGTGGAATGAGCCAGACCACCACGACTTTGACAACGTCTCCATGACCATGCAAGGCTTCCTGAACTACTACGATGCCTGCTCGGAGGGTCTGCGCGCCGCCAGCCCCGCCCTGCGGCTGGGAGGCCCCGGCGACTCCTTCCACACCCCACCGCGATCCCCGCTGAGCTGGGGCCTCCTGCGCCACTGCCACGACGGTACCAACTTCTTCACTGGGGAGGCGGGCGTGCGGCTGGACTACATCTCCCTCCACAGGAAGGGTGCGCGCAGCTCCATCTCCATCCTGGAGCAGGAGAAGGTCGTCGCGCAGCAGATCCGGCAGCTCTTCCCCAAGTTCGCGGACACCCCCATTTACAACGACGAGGCGGACCCGCTGGTGGGCTGGTCCCTGCCACAGCCGTGGAGGGCGGACGTGACCTACGCGGCCATGGTGGTGAAGGTCATCGCGCAGCATCAGAACCTGCTACTGGCCAACACCACCTCCGCCTTCCCCTACGCGCTCCTGAGCAACGACAATGCCTTCCTGAGCTACCACCCGCACCCCTTCGCGCAGCGCACGCTCACCGCGCGCTTCCAGGTCAACAACACCCGCCCGCCGCACGTGCAGCTGTTGCGCAAGCCGGTGCTCACGGCCATGGGGCTGCTGGCGCTGCTGGATGAGGAGCAGCTCTGGGCCGAAGTGTCGCAGGCCGGGACCGTCCTGGACAGCAACCACACGGTGGGCGTCCTGGCCAGCGCCCACCGCCCCCAGGGCCCGGCCGACGCCTGGCGCGCCGCGGTGCTGATCTACGCGAGCGACGACACCCGCGCCCACCCCAACCGCAGCGTCGCGGTGACCCTGCGGCTGCGCGGGGTGCCCCCCGGCCCGGGCCTGGTCTACGTCACGCGCTACCTGGACAACGGGCTCTGCAGCCCCGACGGCGAGTGGCGGCGCCTGGGCCGGCCCGTCTTCCCCACGGCAGAGCAGTTCCGGCGCATGCGCGCGGCTGAGGACCCGGTGGCCGCGGCGCCCCGCCCCTTACCCGCCGGCGGCCGCCTGACCCTGCGCCCCGCGCTGCGGCTGCCGTCGCTTTTGCTGGTGCACGTGTGTGCGCGCCCCGAGAAGCCGCCCGGGCAGGTCACGCGGCTCCGCGCCCTGCCCCTGACCCAAGGGCAGCTGGTTCTGGTCTGGTCGGATGAACACGTGGGCTCCAAGTGCCTGTGGACATACGAGATCCAGTTCTCTCAGGACGGTAAGGCGTACACCCCGGTCAGCAGGAAGCCATCGACCTTCAACCTCTTTGTGTTCAGCCCAGACACAGGTGCTGTCTCTGGCTCCTACCGAGTTCGAGCCCTGGACTACTGGGCCCGACCAGGCCCCTTCTCGGACCCTGTGCCGTACCTGGAGGTCCCTGTGCCAAGAGGGCCCCCATCCCCGGGCAATCCATGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T98430-Ab Anti-IDUA/ IDA/ MPS1 functional antibody
    Target Antigen GM-Tg-g-T98430-Ag IDUA protein
    ORF Viral Vector pGMLP001664 Human IDUA Lentivirus plasmid
    ORF Viral Vector vGMLP001664 Human IDUA Lentivirus particle


    Target information

    Target ID GM-T98430
    Target Name IDUA
    Gene ID 3425, 15932, 106998222, 360904, 101095896, 100505382, 511050, 100146682
    Gene Symbol and Synonyms 6030426D08,IDA,IDUA,MPS1,MPSI
    Uniprot Accession P35475
    Uniprot Entry Name IDUA_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000127415
    Target Classification Not Available

    This gene encodes an enzyme that hydrolyzes the terminal alpha-L-iduronic acid residues of two glycosaminoglycans, dermatan sulfate and heparan sulfate. This hydrolysis is required for the lysosomal degradation of these glycosaminoglycans. Mutations in this gene that result in enzymatic deficiency lead to the autosomal recessive disease mucopolysaccharidosis type I (MPS I). [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.