Human KHDRBS1/p62/p68 ORF/cDNA clone-Lentivirus plasmid (NM_006559)

Cat. No.: pGMLP001679
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human KHDRBS1/p62/p68 Lentiviral expression plasmid for KHDRBS1 lentivirus packaging, KHDRBS1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to KHDRBS1/p62 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $672.96
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001679
Gene Name KHDRBS1
Accession Number NM_006559
Gene ID 10657
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1332 bp
Gene Alias p62,p68,Sam68
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCAGCGCCGGGACGACCCCGCCGCGCGCATGAGCCGGTCTTCGGGCCGTAGCGGCTCCATGGACCCCTCCGGTGCCCACCCCTCGGTGCGTCAGACGCCGTCTCGGCAGCCGCCGCTGCCTCACCGGTCCCGGGGAGGCGGAGGGGGATCCCGCGGGGGCGCCCGGGCCTCGCCCGCCACGCAGCCGCCACCGCTGCTGCCGCCCTCGGCCACGGGTCCCGACGCGACAGTGGGCGGGCCAGCGCCGACCCCGCTGCTGCCCCCCTCGGCCACAGCCTCGGTCAAGATGGAGCCAGAGAACAAGTACCTGCCCGAACTCATGGCCGAGAAGGACTCGCTCGACCCGTCCTTCACTCACGCCATGCAGCTGCTGACGGCAGAAATTGAGAAGATTCAGAAAGGAGACTCAAAAAAGGATGATGAGGAGAATTACTTGGATTTATTTTCTCATAAGAACATGAAACTGAAAGAGCGAGTGCTGATACCTGTCAAGCAGTATCCCAAGTTCAATTTTGTGGGGAAGATTCTTGGACCACAAGGGAATACAATCAAAAGACTGCAGGAAGAGACTGGTGCAAAGATCTCTGTATTGGGAAAGGGCTCAATGAGAGACAAAGCCAAGGAGGAAGAGCTGCGCAAAGGTGGAGACCCCAAATATGCCCACTTGAATATGGATCTGCATGTCTTCATTGAAGTCTTTGGACCCCCATGTGAGGCTTATGCTCTTATGGCCCATGCCATGGAGGAAGTCAAGAAATTTCTAGTACCGGATATGATGGATGATATCTGTCAGGAGCAATTTCTAGAGCTGTCCTACTTGAATGGAGTACCTGAACCCTCTCGTGGACGTGGGGTGCCAGTGAGAGGCCGGGGAGCTGCACCTCCTCCACCACCTGTTCCCAGGGGCCGTGGTGTTGGACCACCTCGGGGGGCTTTGGTACGTGGTACACCAGTAAGGGGAGCCATCACCAGAGGTGCCACTGTGACTCGAGGCGTGCCACCCCCACCTACTGTGAGGGGTGCTCCAGCACCAAGAGCACGGACAGCGGGCATCCAGAGGATACCTTTGCCTCCACCTCCTGCACCAGAAACATATGAAGAATATGGATATGATGATACATACGCAGAACAAAGTTACGAAGGCTACGAAGGCTATTACAGCCAGAGTCAAGGGGACTCAGAATATTATGACTATGGACATGGGGAGGTTCAAGATTCTTATGAAGCTTATGGCCAGGACGACTGGAATGGGACCAGGCCGTCGCTGAAGGCCCCTCCTGCTAGGCCAGTGAAGGGAGCATACAGAGAGCACCCATATGGACGTTATTAA
ORF Protein Sequence MQRRDDPAARMSRSSGRSGSMDPSGAHPSVRQTPSRQPPLPHRSRGGGGGSRGGARASPATQPPPLLPPSATGPDATVGGPAPTPLLPPSATASVKMEPENKYLPELMAEKDSLDPSFTHAMQLLTAEIEKIQKGDSKKDDEENYLDLFSHKNMKLKERVLIPVKQYPKFNFVGKILGPQGNTIKRLQEETGAKISVLGKGSMRDKAKEEELRKGGDPKYAHLNMDLHVFIEVFGPPCEAYALMAHAMEEVKKFLVPDMMDDICQEQFLELSYLNGVPEPSRGRGVPVRGRGAAPPPPPVPRGRGVGPPRGALVRGTPVRGAITRGATVTRGVPPPPTVRGAPAPRARTAGIQRIPLPPPPAPETYEEYGYDDTYAEQSYEGYEGYYSQSQGDSEYYDYGHGEVQDSYEAYGQDDWNGTRPSLKAPPARPVKGAYREHPYGRY

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T80395-Ab Anti-KHDRBS1 monoclonal antibody
    Target Antigen GM-Tg-g-T80395-Ag KHDRBS1 protein
    ORF Viral Vector pGMLP001679 Human KHDRBS1 Lentivirus plasmid
    ORF Viral Vector pGMPC000495 Human KHDRBS1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP001679 Human KHDRBS1 Lentivirus particle


    Target information

    Target ID GM-T80395
    Target Name KHDRBS1
    Gene ID 10657, 20218, 706598, 117268, 101080467, 487316, 538775, 100070402
    Gene Symbol and Synonyms KHDRBS1,p62,p68,Sam68
    Uniprot Accession Q07666
    Uniprot Entry Name KHDR1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000121774
    Target Classification Not Available

    This gene encodes a member of the K homology domain-containing, RNA-binding, signal transduction-associated protein family. The encoded protein appears to have many functions and may be involved in a variety of cellular processes, including alternative splicing, cell cycle regulation, RNA 3'-end formation, tumorigenesis, and regulation of human immunodeficiency virus gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.