Human PDCD2/RP8/ZMYND7 ORF/cDNA clone-Lentivirus plasmid (NM_002598)

Cat. No.: pGMLP001712
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PDCD2/RP8/ZMYND7 Lentiviral expression plasmid for PDCD2 lentivirus packaging, PDCD2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to PD-2/PDCD2/RP8 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $589.8
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001712
Gene Name PDCD2
Accession Number NM_002598
Gene ID 5134
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1035 bp
Gene Alias RP8,ZMYND7
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCTGCCGCCGGGGCCAGGCCTGTGGAGCTGGGCTTCGCCGAGTCGGCGCCGGCGTGGCGACTGCGCAGCGAGCAGTTCCCCAGCAAGGTGGGCGGGCGGCCGGCATGGCTGGGCGCGGCCGGGCTGCCGGGGCCCCAGGCCCTGGCCTGCGAGCTGTGCGGCCGCCCGCTCTCCTTCCTGCTGCAGGTGTATGCGCCGCTGCCTGGCCGCCCGGACGCCTTCCACCGCTGCATCTTCCTCTTCTGCTGCCGCGAGCAGCCGTGCTGTGCCGGCCTGCGAGTTTTTAGGAATCAACTACCCAGGAAAAACGATTTTTACTCATATGAGCCACCTTCTGAGAATCCTCCCCCAGAAACAGGAGAATCAGTGTGTCTCCAGCTTAAGTCTGGTGCTCATCTCTGCAGGGTTTGTGGCTGTTTAGGCCCCAAAACGTGCTCCAGATGCCACAAAGCATATTACTGCAGCAAGGAGCATCAGACCCTAGACTGGAGATTGGGACATAAGCAGGCTTGTGCACAACCAGATCATCTGGACCATATAATTCCAGACCACAACTTCCTTTTTCCAGAATTTGAAATTGTAATAGAAACAGAAGATGAGATTATGCCTGAGGTTGTGGAAAAGGAAGATTACTCAGAGATTATAGGGAGCATGGGTGAAGCACTTGAGGAAGAACTGGATTCCATGGCAAAACATGAATCCAGGGAAGATAAAATTTTTCAGAAGTTTAAAACTCAGATAGCCCTTGAACCAGAACAGATTCTTAGATATGGCAGAGGTATTGCCCCCATCTGGATTTCTGGTGAAAATATTCCTCAAGAAAAGGATATTCCAGATTGCCCCTGTGGTGCCAAGAGAATATTGGAATTCCAGGTCATGCCTCAGCTCCTAAACTACCTGAAGGCTGACAGACTGGGCAAGAGCATTGACTGGGGCATCCTGGCTGTCTTCACCTGTGCTGAGAGCTGCAGCTTGGGTACTGGCTATACAGAAGAATTTGTGTGGAAGCAGGATGTAACAGATACACCGTAA
ORF Protein Sequence MAAAGARPVELGFAESAPAWRLRSEQFPSKVGGRPAWLGAAGLPGPQALACELCGRPLSFLLQVYAPLPGRPDAFHRCIFLFCCREQPCCAGLRVFRNQLPRKNDFYSYEPPSENPPPETGESVCLQLKSGAHLCRVCGCLGPKTCSRCHKAYYCSKEHQTLDWRLGHKQACAQPDHLDHIIPDHNFLFPEFEIVIETEDEIMPEVVEKEDYSEIIGSMGEALEEELDSMAKHESREDKIFQKFKTQIALEPEQILRYGRGIAPIWISGENIPQEKDIPDCPCGAKRILEFQVMPQLLNYLKADRLGKSIDWGILAVFTCAESCSLGTGYTEEFVWKQDVTDTP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T27736-Ab Anti-PD-2 monoclonal antibody
    Target Antigen GM-Tg-g-T27736-Ag PD-2/PDCD2 protein
    ORF Viral Vector pGMLP001712 Human PDCD2 Lentivirus plasmid
    ORF Viral Vector vGMLP001712 Human PDCD2 Lentivirus particle


    Target information

    Target ID GM-T27736
    Target Name PD-2
    Gene ID 5134, 18567, 696380, 58934, 101084453, 475041, 512079, 100051773
    Gene Symbol and Synonyms Pcd2,PDCD2,RP-8,RP8,ZMYND7
    Uniprot Accession Q16342
    Uniprot Entry Name PDCD2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000071994
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a nuclear protein expressed in a variety of tissues. Expression of this gene has been shown to be repressed by B-cell CLL/lymphoma 6 (BCL6), a transcriptional repressor required for lymph node germinal center development, suggesting that BCL6 regulates apoptosis by its effects on this protein. Alternative splicing results in multiple transcript variants and pseudogenes have been identified on chromosomes 9 and 12. [provided by RefSeq, Dec 2010]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.