Human RUNX2/AML3/CBF-alpha-1 ORF/cDNA clone-Lentivirus plasmid (NM_001024630)

Cat. No.: pGMLP001724
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human RUNX2/AML3/CBF-alpha-1 Lentiviral expression plasmid for RUNX2 lentivirus packaging, RUNX2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to RUNX2/AML3 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $785.46
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001724
Gene Name RUNX2
Accession Number NM_001024630
Gene ID 860
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1566 bp
Gene Alias AML3,CBF-alpha-1,CBFA1,CCD,CCD1,CLCD,OSF-2,OSF2,PEA2aA,PEBP2aA
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCATCAAACAGCCTCTTCAGCACAGTGACACCATGTCAGCAAAACTTCTTTTGGGATCCGAGCACCAGCCGGCGCTTCAGCCCCCCCTCCAGCAGCCTGCAGCCCGGCAAAATGAGCGACGTGAGCCCGGTGGTGGCTGCGCAACAGCAGCAGCAACAGCAGCAGCAGCAACAGCAGCAGCAGCAGCAGCAACAGCAGCAGCAGCAGCAGGAGGCGGCGGCGGCGGCTGCGGCGGCGGCGGCGGCTGCGGCGGCGGCAGCTGCAGTGCCCCGGTTGCGGCCGCCCCACGACAACCGCACCATGGTGGAGATCATCGCCGACCACCCGGCCGAACTCGTCCGCACCGACAGCCCCAACTTCCTGTGCTCGGTGCTGCCCTCGCACTGGCGCTGCAACAAGACCCTGCCCGTGGCCTTCAAGGTGGTAGCCCTCGGAGAGGTACCAGATGGGACTGTGGTTACTGTCATGGCGGGTAACGATGAAAATTATTCTGCTGAGCTCCGGAATGCCTCTGCTGTTATGAAAAACCAAGTAGCAAGGTTCAACGATCTGAGATTTGTGGGCCGGAGTGGACGAGGCAAGAGTTTCACCTTGACCATAACCGTCTTCACAAATCCTCCCCAAGTAGCTACCTATCACAGAGCAATTAAAGTTACAGTAGATGGACCTCGGGAACCCAGAAGGCACAGACAGAAGCTTGATGACTCTAAACCTAGTTTGTTCTCTGACCGCCTCAGTGATTTAGGGCGCATTCCTCATCCCAGTATGAGAGTAGGTGTCCCGCCTCAGAACCCACGGCCCTCCCTGAACTCTGCACCAAGTCCTTTTAATCCACAAGGACAGAGTCAGATTACAGACCCCAGGCAGGCACAGTCTTCCCCGCCGTGGTCCTATGACCAGTCTTACCCCTCCTACCTGAGCCAGATGACGTCCCCGTCCATCCACTCTACCACCCCGCTGTCTTCCACACGGGGCACTGGGCTTCCTGCCATCACCGATGTGCCTAGGCGCATTTCAGATGATGACACTGCCACCTCTGACTTCTGCCTCTGGCCTTCCACTCTCAGTAAGAAGAGCCAGGCAGGTGCTTCAGAACTGGGCCCTTTTTCAGACCCCAGGCAGTTCCCAAGCATTTCATCCCTCACTGAGAGCCGCTTCTCCAACCCACGAATGCACTATCCAGCCACCTTTACTTACACCCCGCCAGTCACCTCAGGCATGTCCCTCGGTATGTCCGCCACCACTCACTACCACACCTACCTGCCACCACCCTACCCCGGCTCTTCCCAAAGCCAGAGTGGACCCTTCCAGACCAGCAGCACTCCATATCTCTACTATGGCACTTCGTCAGGATCCTATCAGTTTCCCATGGTGCCGGGGGGAGACCGGTCTCCTTCCAGAATGCTTCCGCCATGCACCACCACCTCGAATGGCAGCACGCTATTAAATCCAAATTTGCCTAACCAGAATGATGGTGTTGACGCTGATGGAAGCCACAGCAGTTCCCCAACTGTTTTGAATTCTAGTGGCAGAATGGATGAATCTGTTTGGCGACCATATTGA
ORF Protein Sequence MASNSLFSTVTPCQQNFFWDPSTSRRFSPPSSSLQPGKMSDVSPVVAAQQQQQQQQQQQQQQQQQQQQQQQEAAAAAAAAAAAAAAAAAVPRLRPPHDNRTMVEIIADHPAELVRTDSPNFLCSVLPSHWRCNKTLPVAFKVVALGEVPDGTVVTVMAGNDENYSAELRNASAVMKNQVARFNDLRFVGRSGRGKSFTLTITVFTNPPQVATYHRAIKVTVDGPREPRRHRQKLDDSKPSLFSDRLSDLGRIPHPSMRVGVPPQNPRPSLNSAPSPFNPQGQSQITDPRQAQSSPPWSYDQSYPSYLSQMTSPSIHSTTPLSSTRGTGLPAITDVPRRISDDDTATSDFCLWPSTLSKKSQAGASELGPFSDPRQFPSISSLTESRFSNPRMHYPATFTYTPPVTSGMSLGMSATTHYHTYLPPPYPGSSQSQSGPFQTSSTPYLYYGTSSGSYQFPMVPGGDRSPSRMLPPCTTTSNGSTLLNPNLPNQNDGVDADGSHSSSPTVLNSSGRMDESVWRPY

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T02259-Ab Anti-RUNX2 monoclonal antibody
    Target Antigen GM-Tg-g-T02259-Ag RUNX2 protein
    ORF Viral Vector pGMLP001724 Human RUNX2 Lentivirus plasmid
    ORF Viral Vector pGMAD000989 Human RUNX2 Adenovirus plasmid
    ORF Viral Vector pGMPC000085 Human RUNX2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000917 Human RUNX2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP001724 Human RUNX2 Lentivirus particle
    ORF Viral Vector vGMAD000989 Human RUNX2 Adenovirus particle


    Target information

    Target ID GM-T02259
    Target Name RUNX2
    Gene ID 860, 12393, 703331, 367218, 101089612, 449531, 536911, 100033890
    Gene Symbol and Synonyms AML3,Cbf,CBF-alpha-1,Cbfa-1,CBFA1,CCD,CCD1,CLCD,LS3,OSF-2,OSF2,PEA2aA,Pebp2a1,PEBP2aA,Pebpa2a,RUNX2
    Uniprot Accession Q13950
    Uniprot Entry Name RUNX2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000124813
    Target Classification Tumor-associated antigen (TAA)

    This gene is a member of the RUNX family of transcription factors and encodes a nuclear protein with an Runt DNA-binding domain. This protein is essential for osteoblastic differentiation and skeletal morphogenesis and acts as a scaffold for nucleic acids and regulatory factors involved in skeletal gene expression. The protein can bind DNA both as a monomer or, with more affinity, as a subunit of a heterodimeric complex. Two regions of potential trinucleotide repeat expansions are present in the N-terminal region of the encoded protein, and these and other mutations in this gene have been associated with the bone development disorder cleidocranial dysplasia (CCD). Transcript variants that encode different protein isoforms result from the use of alternate promoters as well as alternate splicing. [provided by RefSeq, Jul 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.