Human APOM/apo-M/G3a ORF/cDNA clone-Lentivirus plasmid (NM_019101.2)

Cat. No.: pGMLP001913
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human APOM/apo-M/G3a Lentiviral expression plasmid for APOM lentivirus packaging, APOM lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to APOM/apo-M products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $441.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001913
Gene Name APOM
Accession Number NM_019101.2
Gene ID 55937
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 567 bp
Gene Alias apo-M,G3a,HSPC336,NG20
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTTCCACCAAATTTGGGCAGCTCTGCTCTACTTCTATGGTATTATCCTTAACTCCATCTACCAGTGCCCTGAGCACAGTCAACTGACAACTCTGGGCGTGGATGGGAAGGAGTTCCCAGAGGTCCACTTGGGCCAGTGGTACTTTATCGCAGGGGCAGCTCCCACCAAGGAGGAGTTGGCAACTTTTGACCCTGTGGACAACATTGTCTTCAATATGGCTGCTGGCTCTGCCCCGATGCAGCTCCACCTTCGTGCTACCATCCGCATGAAAGATGGGCTCTGTGTGCCCCGGAAATGGATCTACCACCTGACTGAAGGGAGCACAGATCTCAGAACTGAAGGCCGCCCTGACATGAAGACTGAGCTCTTTTCCAGCTCATGCCCAGGTGGAATCATGCTGAATGAGACAGGCCAGGGTTACCAGCGCTTTCTCCTCTACAATCGCTCACCACATCCTCCCGAAAAGTGTGTGGAGGAATTCAAGTCCCTGACTTCCTGCCTGGACTCCAAAGCCTTCTTATTGACTCCTAGGAATCAAGAGGCCTGTGAGCTGTCCAATAACTGA
ORF Protein Sequence MFHQIWAALLYFYGIILNSIYQCPEHSQLTTLGVDGKEFPEVHLGQWYFIAGAAPTKEELATFDPVDNIVFNMAAGSAPMQLHLRATIRMKDGLCVPRKWIYHLTEGSTDLRTEGRPDMKTELFSSSCPGGIMLNETGQGYQRFLLYNRSPHPPEKCVEEFKSLTSCLDSKAFLLTPRNQEACELSNN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0676-Ab Anti-APOM/ G3a/ HSPC336 functional antibody
    Target Antigen GM-Tg-g-SE0676-Ag APOM protein
    ORF Viral Vector pGMLP001913 Human APOM Lentivirus plasmid
    ORF Viral Vector vGMLP001913 Human APOM Lentivirus particle


    Target information

    Target ID GM-SE0676
    Target Name APOM
    Gene ID 55937, 55938, 715848, 55939, 101086722, 474843, 505830, 100050362
    Gene Symbol and Synonyms 1190010O19Rik,apo-M,APOM,G3a,HSPC336,NG20
    Uniprot Accession O95445
    Uniprot Entry Name APOM_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Acute kidney failure, Malignant neoplasm of bladder
    Gene Ensembl ENSG00000204444
    Target Classification Not Available

    The protein encoded by this gene is an apolipoprotein and member of the lipocalin protein family. It is found associated with high density lipoproteins and to a lesser extent with low density lipoproteins and triglyceride-rich lipoproteins. The encoded protein is secreted through the plasma membrane but remains membrane-bound, where it is involved in lipid transport. Alternate splicing results in both coding and non-coding variants of this gene. [provided by RefSeq, Jan 2012]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.