Human ARRB2/ARB2/ARR2 ORF/cDNA clone-Lentivirus plasmid (NM_001257328.1)

Cat. No.: pGMLP001914
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human ARRB2/ARB2/ARR2 Lentiviral expression plasmid for ARRB2 lentivirus packaging, ARRB2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to ARRB2/ARB2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $662.04
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001914
Gene Name ARRB2
Accession Number NM_001257328.1
Gene ID 409
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1293 bp
Gene Alias ARB2,ARR2,BARR2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGGGAGAAACCCGGGACCAGGGTCTTCAAGAAGTCGAGCCCTAACTGCAAGCTCACCGTGTACTTGGGCAAGCGGGACTTCGTAGATCACCTGGACAAAGTGGACCCTGTAGATGGCGTGGTGCTTGTGGACCCTGACTACCTGAAGGACCGCAAAGTGTTTGTGACCCTCACCTGCGCCTTCCGCTATGGCCGTGAAGACCTGGATGTGCTGGGCTTGTCCTTCCGCAAAGACCTGTTCATCGCCACCTACCAGGCCTTCCCCCCGGTGCCCAACCCACCCCGGCCCCCCACCCGCCTGCAGGACCGGCTGCTGAGGAAGCTGGGCCAGCATGCCCACCCCTTCTTCTTCACCGTGAGGATGCCCCTGCCCTCTGAGGGCCAGGGGGCTGGGGCTGGGACTGTGTCTGGGGTGGGGATACCCCAGAATCTTCCATGCTCCGTCACACTGCAGCCAGGCCCAGAGGATACAGGAAAGGCCTGCGGCGTAGACTTTGAGATTCGAGCCTTCTGTGCTAAATCACTAGAAGAGAAAAGCCACAAAAGGAACTCTGTGCGGCTGGTGATCCGAAAGGTGCAGTTCGCCCCGGAGAAACCCGGCCCCCAGCCTTCAGCCGAAACCACACGCCACTTCCTCATGTCTGACCGGTCCCTGCACCTCGAGGCTTCCCTGGACAAGGAGCTGTACTACCATGGGGAGCCCCTCAATGTAAATGTCCACGTCACCAACAACTCCACCAAGACCGTCAAGAAGATCAAAGTCTCTGTGAGACAGTACGCCGACATCTGCCTCTTCAGCACCGCCCAGTACAAGTGTCCTGTGGCTCAACTCGAACAAGATGACCAGGTATCTCCCAGCTCCACATTCTGTAAGGTGTACACCATAACCCCACTGCTCAGCGACAACCGGGAGAAGCGGGGTCTCGCCCTGGATGGGAAACTCAAGCACGAGGACACCAACCTGGCTTCCAGCACCATCGTGAAGGAGGGTGCCAACAAGGAGGTGCTGGGAATCCTGGTGTCCTACAGGGTCAAGGTGAAGCTGGTGGTGTCTCGAGGCGGGGATGTCTCTGTGGAGCTGCCTTTTGTTCTTATGCACCCCAAGCCCCACGACCACATCCCCCTCCCCAGACCCCAGTCAGCCGCTCCGGAGACAGATGTCCCTGTGGACACCAACCTCATTGAATTTGATACCAACTATGCCACAGATGATGACATTGTGTTTGAGGACTTTGCCCGGCTTCGGCTGAAGGGGATGAAGGATGACGACTATGATGATCAACTCTGCTAG
ORF Protein Sequence MGEKPGTRVFKKSSPNCKLTVYLGKRDFVDHLDKVDPVDGVVLVDPDYLKDRKVFVTLTCAFRYGREDLDVLGLSFRKDLFIATYQAFPPVPNPPRPPTRLQDRLLRKLGQHAHPFFFTVRMPLPSEGQGAGAGTVSGVGIPQNLPCSVTLQPGPEDTGKACGVDFEIRAFCAKSLEEKSHKRNSVRLVIRKVQFAPEKPGPQPSAETTRHFLMSDRSLHLEASLDKELYYHGEPLNVNVHVTNNSTKTVKKIKVSVRQYADICLFSTAQYKCPVAQLEQDDQVSPSSTFCKVYTITPLLSDNREKRGLALDGKLKHEDTNLASSTIVKEGANKEVLGILVSYRVKVKLVVSRGGDVSVELPFVLMHPKPHDHIPLPRPQSAAPETDVPVDTNLIEFDTNYATDDDIVFEDFARLRLKGMKDDDYDDQLC

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T16243-Ab Anti-ARRB2 monoclonal antibody
    Target Antigen GM-Tg-g-T16243-Ag ARRB2 protein
    ORF Viral Vector pGMLP001914 Human ARRB2 Lentivirus plasmid
    ORF Viral Vector vGMLP001914 Human ARRB2 Lentivirus particle


    Target information

    Target ID GM-T16243
    Target Name ARRB2
    Gene ID 409, 216869, 709399, 25388, 101093558, 607262, 281638, 100072892
    Gene Symbol and Synonyms ARB2,ARR2,Arr3,ARRB2,BARR2,BARRES
    Uniprot Accession P32121
    Uniprot Entry Name ARRB2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000141480
    Target Classification Not Available

    Members of arrestin/beta-arrestin protein family are thought to participate in agonist-mediated desensitization of G-protein-coupled receptors and cause specific dampening of cellular responses to stimuli such as hormones, neurotransmitters, or sensory signals. Arrestin beta 2, like arrestin beta 1, was shown to inhibit beta-adrenergic receptor function in vitro. It is expressed at high levels in the central nervous system and may play a role in the regulation of synaptic receptors. Besides the brain, a cDNA for arrestin beta 2 was isolated from thyroid gland, and thus it may also be involved in hormone-specific desensitization of TSH receptors. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.