Human SERPINE2/GDN/GDNPF ORF/cDNA clone-Lentivirus plasmid (NM_006216.3)

Cat. No.: pGMLP002005
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SERPINE2/GDN/GDNPF Lentiviral expression plasmid for SERPINE2 lentivirus packaging, SERPINE2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to SERPINE2/GDN products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $635.16
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002005
Gene Name SERPINE2
Accession Number NM_006216.3
Gene ID 5270
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1197 bp
Gene Alias GDN,GDNPF,PI-7,PI7,PN-1,PN1,PNI
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAACTGGCATCTCCCCCTCTTCCTCTTGGCCTCTGTGACGCTGCCTTCCATCTGCTCCCACTTCAATCCTCTGTCTCTCGAGGAACTAGGCTCCAACACGGGGATCCAGGTTTTCAATCAGATTGTGAAGTCGAGGCCTCATGACAACATCGTGATCTCTCCCCATGGGATTGCGTCGGTCCTGGGGATGCTTCAGCTGGGGGCGGACGGCAGGACCAAGAAGCAGCTCGCCATGGTGATGAGATACGGCGTAAATGGAGTTGGTAAAATATTAAAGAAGATCAACAAGGCCATCGTCTCCAAGAAGAATAAAGACATTGTGACAGTGGCTAACGCCGTGTTTGTTAAGAATGCCTCTGAAATTGAAGTGCCTTTTGTTACAAGGAACAAAGATGTGTTCCAGTGTGAGGTCCGGAATGTGAACTTTGAGGATCCAGCCTCTGCCTGTGATTCCATCAATGCATGGGTTAAAAATGAAACCAGGGATATGATTGACAATCTGCTGTCCCCAGATCTTATTGATGGTGTGCTCACCAGACTGGTCCTCGTCAACGCAGTGTATTTCAAGGGTCTGTGGAAATCACGGTTCCAACCCGAGAACACAAAGAAACGCACTTTCGTGGCAGCCGACGGGAAATCCTATCAAGTGCCAATGCTGGCCCAGCTCTCCGTGTTCCGGTGTGGGTCGACAAGTGCCCCCAATGATTTATGGTACAACTTCATTGAACTGCCCTACCACGGGGAAAGCATCAGCATGCTGATTGCACTGCCGACTGAGAGCTCCACTCCGCTGTCTGCCATCATCCCACACATCAGCACCAAGACCATAGACAGCTGGATGAGCATCATGGTGCCCAAGAGGGTGCAGGTGATCCTGCCCAAGTTCACAGCTGTAGCACAAACAGATTTGAAGGAGCCGCTGAAAGTTCTTGGCATTACTGACATGTTTGATTCATCAAAGGCAAATTTTGCAAAAATAACAACAGGGTCAGAAAACCTCCATGTTTCTCATATCTTGCAAAAAGCAAAAATTGAAGTCAGTGAAGATGGAACCAAAGCTTCAGCAGCAACAACTGCAATTCTCATTGCAAGATCATCGCCTCCCTGGTTTATAGTAGACAGACCTTTTCTGTTTTTCATCCGACATAATCCTACAGGTGCTGTGTTATTCATGGGGCAGATAAACAAACCCTGA
ORF Protein Sequence MNWHLPLFLLASVTLPSICSHFNPLSLEELGSNTGIQVFNQIVKSRPHDNIVISPHGIASVLGMLQLGADGRTKKQLAMVMRYGVNGVGKILKKINKAIVSKKNKDIVTVANAVFVKNASEIEVPFVTRNKDVFQCEVRNVNFEDPASACDSINAWVKNETRDMIDNLLSPDLIDGVLTRLVLVNAVYFKGLWKSRFQPENTKKRTFVAADGKSYQVPMLAQLSVFRCGSTSAPNDLWYNFIELPYHGESISMLIALPTESSTPLSAIIPHISTKTIDSWMSIMVPKRVQVILPKFTAVAQTDLKEPLKVLGITDMFDSSKANFAKITTGSENLHVSHILQKAKIEVSEDGTKASAATTAILIARSSPPWFIVDRPFLFFIRHNPTGAVLFMGQINKP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0469-Ab Anti-GDN/ SERPINE2/ GDNPF functional antibody
    Target Antigen GM-Tg-g-SE0469-Ag SERPINE2 protein
    ORF Viral Vector pGMLP002005 Human SERPINE2 Lentivirus plasmid
    ORF Viral Vector pGMLV000820 Human SERPINE2 Lentivirus plasmid
    ORF Viral Vector vGMLP002005 Human SERPINE2 Lentivirus particle
    ORF Viral Vector vGMLV000820 Human SERPINE2 Lentivirus particle


    Target information

    Target ID GM-SE0469
    Target Name SERPINE2
    Gene ID 5270, 20720, 707121, 29366, 101084306, 608930, 282521, 111767501
    Gene Symbol and Synonyms B230326M24Rik,CRG,GDN,GDNPF,Gdnpn1,PAI-1,PI-7,PI7,PN-1,PN1,PNI,SERPINE1,SERPINE2,Spi4,Spin4
    Uniprot Accession P07093
    Uniprot Entry Name GDN_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000135919
    Target Classification Not Available

    This gene encodes a member of the serpin family of proteins, a group of proteins that inhibit serine proteases. Thrombin, urokinase, plasmin and trypsin are among the proteases that this family member can inhibit. This gene is a susceptibility gene for chronic obstructive pulmonary disease and for emphysema. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.