Human SERPINE2/GDN/GDNPF ORF/cDNA clone-Lentivirus plasmid (NM_006216.3)
Cat. No.: pGMLP002005
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human SERPINE2/GDN/GDNPF Lentiviral expression plasmid for SERPINE2 lentivirus packaging, SERPINE2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
SERPINE2/GDN products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP002005 |
Gene Name | SERPINE2 |
Accession Number | NM_006216.3 |
Gene ID | 5270 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1197 bp |
Gene Alias | GDN,GDNPF,PI-7,PI7,PN-1,PN1,PNI |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGAACTGGCATCTCCCCCTCTTCCTCTTGGCCTCTGTGACGCTGCCTTCCATCTGCTCCCACTTCAATCCTCTGTCTCTCGAGGAACTAGGCTCCAACACGGGGATCCAGGTTTTCAATCAGATTGTGAAGTCGAGGCCTCATGACAACATCGTGATCTCTCCCCATGGGATTGCGTCGGTCCTGGGGATGCTTCAGCTGGGGGCGGACGGCAGGACCAAGAAGCAGCTCGCCATGGTGATGAGATACGGCGTAAATGGAGTTGGTAAAATATTAAAGAAGATCAACAAGGCCATCGTCTCCAAGAAGAATAAAGACATTGTGACAGTGGCTAACGCCGTGTTTGTTAAGAATGCCTCTGAAATTGAAGTGCCTTTTGTTACAAGGAACAAAGATGTGTTCCAGTGTGAGGTCCGGAATGTGAACTTTGAGGATCCAGCCTCTGCCTGTGATTCCATCAATGCATGGGTTAAAAATGAAACCAGGGATATGATTGACAATCTGCTGTCCCCAGATCTTATTGATGGTGTGCTCACCAGACTGGTCCTCGTCAACGCAGTGTATTTCAAGGGTCTGTGGAAATCACGGTTCCAACCCGAGAACACAAAGAAACGCACTTTCGTGGCAGCCGACGGGAAATCCTATCAAGTGCCAATGCTGGCCCAGCTCTCCGTGTTCCGGTGTGGGTCGACAAGTGCCCCCAATGATTTATGGTACAACTTCATTGAACTGCCCTACCACGGGGAAAGCATCAGCATGCTGATTGCACTGCCGACTGAGAGCTCCACTCCGCTGTCTGCCATCATCCCACACATCAGCACCAAGACCATAGACAGCTGGATGAGCATCATGGTGCCCAAGAGGGTGCAGGTGATCCTGCCCAAGTTCACAGCTGTAGCACAAACAGATTTGAAGGAGCCGCTGAAAGTTCTTGGCATTACTGACATGTTTGATTCATCAAAGGCAAATTTTGCAAAAATAACAACAGGGTCAGAAAACCTCCATGTTTCTCATATCTTGCAAAAAGCAAAAATTGAAGTCAGTGAAGATGGAACCAAAGCTTCAGCAGCAACAACTGCAATTCTCATTGCAAGATCATCGCCTCCCTGGTTTATAGTAGACAGACCTTTTCTGTTTTTCATCCGACATAATCCTACAGGTGCTGTGTTATTCATGGGGCAGATAAACAAACCCTGA |
ORF Protein Sequence | MNWHLPLFLLASVTLPSICSHFNPLSLEELGSNTGIQVFNQIVKSRPHDNIVISPHGIASVLGMLQLGADGRTKKQLAMVMRYGVNGVGKILKKINKAIVSKKNKDIVTVANAVFVKNASEIEVPFVTRNKDVFQCEVRNVNFEDPASACDSINAWVKNETRDMIDNLLSPDLIDGVLTRLVLVNAVYFKGLWKSRFQPENTKKRTFVAADGKSYQVPMLAQLSVFRCGSTSAPNDLWYNFIELPYHGESISMLIALPTESSTPLSAIIPHISTKTIDSWMSIMVPKRVQVILPKFTAVAQTDLKEPLKVLGITDMFDSSKANFAKITTGSENLHVSHILQKAKIEVSEDGTKASAATTAILIARSSPPWFIVDRPFLFFIRHNPTGAVLFMGQINKP |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0469-Ab | Anti-GDN/ SERPINE2/ GDNPF functional antibody |
Target Antigen | GM-Tg-g-SE0469-Ag | SERPINE2 protein |
ORF Viral Vector | pGMLP002005 | Human SERPINE2 Lentivirus plasmid |
ORF Viral Vector | pGMLV000820 | Human SERPINE2 Lentivirus plasmid |
ORF Viral Vector | vGMLP002005 | Human SERPINE2 Lentivirus particle |
ORF Viral Vector | vGMLV000820 | Human SERPINE2 Lentivirus particle |
Target information
Target ID | GM-SE0469 |
Target Name | SERPINE2 |
Gene ID | 5270, 20720, 707121, 29366, 101084306, 608930, 282521, 111767501 |
Gene Symbol and Synonyms | B230326M24Rik,CRG,GDN,GDNPF,Gdnpn1,PAI-1,PI-7,PI7,PN-1,PN1,PNI,SERPINE1,SERPINE2,Spi4,Spin4 |
Uniprot Accession | P07093 |
Uniprot Entry Name | GDN_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000135919 |
Target Classification | Not Available |
This gene encodes a member of the serpin family of proteins, a group of proteins that inhibit serine proteases. Thrombin, urokinase, plasmin and trypsin are among the proteases that this family member can inhibit. This gene is a susceptibility gene for chronic obstructive pulmonary disease and for emphysema. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.