Human RNASEH2A/AGS4/JUNB ORF/cDNA clone-Lentivirus plasmid (NM_006397)

Cat. No.: pGMLP002179
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human RNASEH2A/AGS4/JUNB Lentiviral expression plasmid for RNASEH2A lentivirus packaging, RNASEH2A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to RNASEH2A/AGS4 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $525
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002179
Gene Name RNASEH2A
Accession Number NM_006397
Gene ID 10535
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 900 bp
Gene Alias AGS4,JUNB,RNASEHI,RNHIA,RNHL
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGATCTCAGCGAGCTGGAGAGAGACAATACAGGCCGCTGTCGCCTGAGTTCGCCTGTGCCCGCGGTGTGCCGCAAGGAGCCTTGCGTCCTGGGCGTCGATGAGGCGGGCAGGGGCCCCGTGCTGGGCCCCATGGTCTACGCCATCTGTTATTGTCCCCTGCCTCGCCTGGCAGATCTGGAGGCGCTGAAAGTGGCAGACTCAAAGACCCTATTGGAGAGCGAGCGGGAAAGGCTGTTTGCGAAAATGGAGGACACGGACTTTGTCGGCTGGGCGCTGGATGTGCTGTCTCCAAACCTCATCTCTACCAGCATGCTTGGGCGGGTCAAATACAACCTGAACTCCCTGTCACATGATACAGCCACTGGGCTTATACAGTATGCATTGGACCAGGGCGTGAACGTCACCCAGGTATTCGTGGACACCGTAGGGATGCCAGAGACATACCAGGCGCGGCTGCAGCAAAGTTTTCCCGGGATTGAGGTGACGGTCAAGGCCAAAGCAGATGCCCTCTACCCGGTGGTTAGTGCTGCCAGCATCTGTGCCAAGGTGGCCCGGGACCAGGCCGTGAAGAAATGGCAGTTCGTGGAGAAACTGCAGGACTTGGATACTGATTATGGCTCAGGCTACCCCAATGATCCCAAGACAAAAGCGTGGTTGAAGGAGCACGTGGAGCCTGTGTTCGGCTTCCCCCAGTTTGTCCGGTTCAGCTGGCGCACGGCCCAGACCATCCTGGAGAAAGAGGCGGAAGATGTTATATGGGAGGACTCAGCATCCGAGAATCAGGAGGGACTCAGGAAGATCACATCCTACTTCCTCAATGAAGGGTCCCAAGCCCGTCCCCGTTCTTCCCACCGATATTTCCTGGAACGCGGCCTGGAGTCAGCAACCAGCCTCTAG
ORF Protein Sequence MDLSELERDNTGRCRLSSPVPAVCRKEPCVLGVDEAGRGPVLGPMVYAICYCPLPRLADLEALKVADSKTLLESERERLFAKMEDTDFVGWALDVLSPNLISTSMLGRVKYNLNSLSHDTATGLIQYALDQGVNVTQVFVDTVGMPETYQARLQQSFPGIEVTVKAKADALYPVVSAASICAKVARDQAVKKWQFVEKLQDLDTDYGSGYPNDPKTKAWLKEHVEPVFGFPQFVRFSWRTAQTILEKEAEDVIWEDSASENQEGLRKITSYFLNEGSQARPRSSHRYFLERGLESATSL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-TA020-Ab Anti-RNASEH2A monoclonal antibody
    Target Antigen GM-Tg-g-TA020-Ag RNASEH2A protein
    ORF Viral Vector pGMLP002179 Human RNASEH2A Lentivirus plasmid
    ORF Viral Vector vGMLP002179 Human RNASEH2A Lentivirus particle


    Target information

    Target ID GM-TA020
    Target Name RNASEH2A
    Gene ID 10535, 69724, 716701, 364974, 101086121, 100856442, 512830, 100064237
    Gene Symbol and Synonyms 2400006P09Rik,AGS4,JUNB,RNASEH2A,RNASEHI,RNHIA,RNHL,THSD8
    Uniprot Accession O75792
    Uniprot Entry Name RNH2A_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000104889
    Target Classification Not Available

    The protein encoded by this gene is a component of the heterotrimeric type II ribonuclease H enzyme (RNAseH2). RNAseH2 is the major source of ribonuclease H activity in mammalian cells and endonucleolytically cleaves ribonucleotides. It is predicted to remove Okazaki fragment RNA primers during lagging strand DNA synthesis and to excise single ribonucleotides from DNA-DNA duplexes. Mutations in this gene cause Aicardi-Goutieres Syndrome (AGS), a an autosomal recessive neurological disorder characterized by progressive microcephaly and psychomotor retardation, intracranial calcifications, elevated levels of interferon-alpha and white blood cells in the cerebrospinal fluid.[provided by RefSeq, Aug 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.