Human TAGLN2/HA1756 ORF/cDNA clone-Lentivirus plasmid (NM_003564)
Cat. No.: pGMLP002198
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human TAGLN2/HA1756 Lentiviral expression plasmid for TAGLN2 lentivirus packaging, TAGLN2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
TAGLN2/HA1756 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP002198 |
Gene Name | TAGLN2 |
Accession Number | NM_003564 |
Gene ID | 8407 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 600 bp |
Gene Alias | HA1756 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCCAACAGGGGACCTGCATATGGCCTGAGCCGGGAGGTGCAGCAGAAGATTGAGAAACAATATGATGCAGATCTGGAGCAGATCCTGATCCAGTGGATCACCACCCAGTGCCGAAAGGATGTGGGCCGGCCCCAGCCTGGACGCGAGAACTTCCAGAACTGGCTCAAGGATGGCACGGTGCTATGTGAGCTCATTAATGCACTGTACCCCGAGGGGCAGGCCCCAGTAAAGAAGATCCAGGCCTCCACCATGGCCTTCAAGCAGATGGAGCAGATCTCTCAGTTCCTGCAAGCAGCTGAGCGCTATGGCATTAACACCACTGACATCTTCCAAACTGTGGACCTCTGGGAAGGAAAGAACATGGCCTGTGTGCAGCGGACGCTGATGAATCTGGGTGGGCTGGCAGTAGCCCGAGATGATGGGCTCTTCTCTGGGGATCCCAACTGGTTCCCTAAGAAATCCAAGGAGAATCCTCGGAACTTCTCGGATAACCAGCTGCAAGAGGGCAAGAACGTGATCGGGTTACAGATGGGCACCAACCGCGGGGCGTCTCAGGCAGGCATGACTGGCTACGGGATGCCACGCCAGATCCTCTGA |
ORF Protein Sequence | MANRGPAYGLSREVQQKIEKQYDADLEQILIQWITTQCRKDVGRPQPGRENFQNWLKDGTVLCELINALYPEGQAPVKKIQASTMAFKQMEQISQFLQAAERYGINTTDIFQTVDLWEGKNMACVQRTLMNLGGLAVARDDGLFSGDPNWFPKKSKENPRNFSDNQLQEGKNVIGLQMGTNRGASQAGMTGYGMPRQIL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T93147-Ab | Anti-TAGL2/ TAGLN2/ HA1756 functional antibody |
Target Antigen | GM-Tg-g-T93147-Ag | TAGLN2 protein |
ORF Viral Vector | pGMLP002198 | Human TAGLN2 Lentivirus plasmid |
ORF Viral Vector | vGMLP002198 | Human TAGLN2 Lentivirus particle |
Target information
Target ID | GM-T93147 |
Target Name | TAGLN2 |
Gene ID | 8407, 21346, 719527, 304983, 101098189, 610210, 282379, 100053621 |
Gene Symbol and Synonyms | 2700094C18Rik,HA1756,Sm22a,Sm22B,SM22beta,TAGLN2 |
Uniprot Accession | P37802 |
Uniprot Entry Name | TAGL2_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Ovary Cancer |
Gene Ensembl | ENSG00000158710 |
Target Classification | Not Available |
The protein encoded by this gene is similar to the protein transgelin, which is one of the earliest markers of differentiated smooth muscle. The specific function of this protein has not yet been determined, although it is thought to be a tumor suppressor. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2013]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.