Human TAGLN2/HA1756 ORF/cDNA clone-Lentivirus plasmid (NM_003564)

Cat. No.: pGMLP002198
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TAGLN2/HA1756 Lentiviral expression plasmid for TAGLN2 lentivirus packaging, TAGLN2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to TAGLN2/HA1756 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002198
Gene Name TAGLN2
Accession Number NM_003564
Gene ID 8407
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 600 bp
Gene Alias HA1756
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCAACAGGGGACCTGCATATGGCCTGAGCCGGGAGGTGCAGCAGAAGATTGAGAAACAATATGATGCAGATCTGGAGCAGATCCTGATCCAGTGGATCACCACCCAGTGCCGAAAGGATGTGGGCCGGCCCCAGCCTGGACGCGAGAACTTCCAGAACTGGCTCAAGGATGGCACGGTGCTATGTGAGCTCATTAATGCACTGTACCCCGAGGGGCAGGCCCCAGTAAAGAAGATCCAGGCCTCCACCATGGCCTTCAAGCAGATGGAGCAGATCTCTCAGTTCCTGCAAGCAGCTGAGCGCTATGGCATTAACACCACTGACATCTTCCAAACTGTGGACCTCTGGGAAGGAAAGAACATGGCCTGTGTGCAGCGGACGCTGATGAATCTGGGTGGGCTGGCAGTAGCCCGAGATGATGGGCTCTTCTCTGGGGATCCCAACTGGTTCCCTAAGAAATCCAAGGAGAATCCTCGGAACTTCTCGGATAACCAGCTGCAAGAGGGCAAGAACGTGATCGGGTTACAGATGGGCACCAACCGCGGGGCGTCTCAGGCAGGCATGACTGGCTACGGGATGCCACGCCAGATCCTCTGA
ORF Protein Sequence MANRGPAYGLSREVQQKIEKQYDADLEQILIQWITTQCRKDVGRPQPGRENFQNWLKDGTVLCELINALYPEGQAPVKKIQASTMAFKQMEQISQFLQAAERYGINTTDIFQTVDLWEGKNMACVQRTLMNLGGLAVARDDGLFSGDPNWFPKKSKENPRNFSDNQLQEGKNVIGLQMGTNRGASQAGMTGYGMPRQIL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T93147-Ab Anti-TAGL2/ TAGLN2/ HA1756 functional antibody
    Target Antigen GM-Tg-g-T93147-Ag TAGLN2 protein
    ORF Viral Vector pGMLP002198 Human TAGLN2 Lentivirus plasmid
    ORF Viral Vector vGMLP002198 Human TAGLN2 Lentivirus particle


    Target information

    Target ID GM-T93147
    Target Name TAGLN2
    Gene ID 8407, 21346, 719527, 304983, 101098189, 610210, 282379, 100053621
    Gene Symbol and Synonyms 2700094C18Rik,HA1756,Sm22a,Sm22B,SM22beta,TAGLN2
    Uniprot Accession P37802
    Uniprot Entry Name TAGL2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Ovary Cancer
    Gene Ensembl ENSG00000158710
    Target Classification Not Available

    The protein encoded by this gene is similar to the protein transgelin, which is one of the earliest markers of differentiated smooth muscle. The specific function of this protein has not yet been determined, although it is thought to be a tumor suppressor. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2013]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.