Human CREB3L3/CREB-H/CREBH ORF/cDNA clone-Lentivirus plasmid (NM_032607.2)

Cat. No.: pGMLP002227
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CREB3L3/CREB-H/CREBH Lentiviral expression plasmid for CREB3L3 lentivirus packaging, CREB3L3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to CREB3L3/CREB-H products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $688.08
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002227
Gene Name CREB3L3
Accession Number NM_032607.2
Gene ID 84699
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1386 bp
Gene Alias CREB-H,CREBH,HYST1481
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAATACGGATTTAGCTGCTGGAAAGATGGCTTCTGCTGCCTGCTCCATGGACCCCATCGACAGCTTTGAGCTCCTGGATCTCCTGTTTGACCGGCAGGACGGCATCCTGAGACACGTGGAGCTGGGCGAGGGCTGGGGTCACGTCAAGGACCAGCAGGTCCTGCCAAACCCCGACTCTGACGACTTCCTCAGCTCCATCCTGGGCTCTGGAGACTCACTGCCCAGCTCCCCACTCTGGTCCCCCGAAGGCAGTGATAGTGGCATCTCCGAAGACCTCCCCTCCGACCCCCAGGACACCCCTCCACGCAGCGGACCAGCCACCTCCCCCGCCGGCTGCCATCCTGCCCAGCCTGGCAAGGGGCCCTGCCTCTCCTATCATCCTGGCAACTCTTGCTCCACCACAACCCCAGGGCCAGTGATCCAAGTACCTGAAGCCTCTGTGACCATAGACCTGGAAATGTGGAGCCCAGGAGGAAGGATCTGTGCTGAGAAGCCGGCTGATCCGGTGGACCTGTCCCCACGATGCAATCTCACCGTGAAAGACCTCCTCCTTTCGGGCAGCAGTGGGGACCTGCAACAGCATCACCTGGGGGCCTCCTACCTCCTGCGACCTGGGGCTGGGCACTGTCAGGAGCTGGTGCTCACCGAGGATGAGAAGAAGCTGCTGGCTAAAGAAGGCATCACCCTGCCCACTCAGCTGCCCCTCACTAAGTACGAGGAGCGAGTGCTGAAAAAAATCCGCCGGAAAATCCGGAACAAGCAGTCGGCGCAAGAAAGCAGGAAGAAGAAGAAGGAATATATCGATGGCCTGGAGACTCGGATGTCAGCTTGCACTGCTCAGAATCAGGAGTTACAGAGGAAAGTCTTGCATCTCGAGAAGCAAAACCTGTCCCTCTTGGAGCAACTGAAGAAACTCCAGGCCATTGTGGTGCAGTCCACCAGCAAGTCAGCCCAGACAGGCACCTGTGTCGCAGTCCTGTTGCTGTCCTTTGCCCTCATCATCCTCCCCTCCATCAGCCCTTTTGGCCCCAACAAAACCGAGAGCCCTGGGGACTTTGCGCCTGTACGAGTGTTCTCCAGAACTTTGCACAACGATGCTGCCTCCCGCGTGGCTGCTGATGCTGTGCCAGGCTCCGAGGCCCCAGGACCCCGACCCGAGGCTGACACAACCCGAGAAGAGTCTCCAGGAAGCCCCGGGGCAGACTGGGGCTTCCAGGACACCGCGAACCTGACCAATTCGACGGAGGAGCTGGACAACGCCACCCTGGTCCTGAGGAATGCAACAGAGGGGCTGGGCCAGGTCGCCCTGCTGGACTGGGTGGCGCCTGGGCCGAGCACTGGCTCAGGACGTGCAGGGCTGGAGGCGGCGGGAGACGAGCTGTGA
ORF Protein Sequence MNTDLAAGKMASAACSMDPIDSFELLDLLFDRQDGILRHVELGEGWGHVKDQQVLPNPDSDDFLSSILGSGDSLPSSPLWSPEGSDSGISEDLPSDPQDTPPRSGPATSPAGCHPAQPGKGPCLSYHPGNSCSTTTPGPVIQVPEASVTIDLEMWSPGGRICAEKPADPVDLSPRCNLTVKDLLLSGSSGDLQQHHLGASYLLRPGAGHCQELVLTEDEKKLLAKEGITLPTQLPLTKYEERVLKKIRRKIRNKQSAQESRKKKKEYIDGLETRMSACTAQNQELQRKVLHLEKQNLSLLEQLKKLQAIVVQSTSKSAQTGTCVAVLLLSFALIILPSISPFGPNKTESPGDFAPVRVFSRTLHNDAASRVAADAVPGSEAPGPRPEADTTREESPGSPGADWGFQDTANLTNSTEELDNATLVLRNATEGLGQVALLDWVAPGPSTGSGRAGLEAAGDEL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0613-Ab Anti-CREB3L3 monoclonal antibody
    Target Antigen GM-Tg-g-IP0613-Ag CREB3L3 protein
    ORF Viral Vector pGMLP002227 Human CREB3L3 Lentivirus plasmid
    ORF Viral Vector vGMLP002227 Human CREB3L3 Lentivirus particle


    Target information

    Target ID GM-IP0613
    Target Name CREB3L3
    Gene ID 84699, 208677, 721825, 314638, 101089838, 485046, 513010, 100063153
    Gene Symbol and Synonyms CREB-H,CREB3L3,CREBH,D10Bur1e,HYST1481,HYTG2
    Uniprot Accession Q68CJ9
    Uniprot Entry Name CR3L3_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000060566
    Target Classification Not Available

    This gene encodes a member of the basic-leucine zipper family and the AMP-dependent transcription factor family. The encoded protein is localized to the endoplasmic reticulum and acts as a transcription factor activated by cyclic AMP stimulation. The encoded protein binds the cyclic AMP response element (CRE) and the box-B element and has been linked to acute inflammatory response, hepatocellular carcinoma, triglyceride metabolism, and hepcidin expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.