Human GIP ORF/cDNA clone-Lentivirus plasmid (NM_004123)

Cat. No.: pGMLP002329
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human GIP/ Lentiviral expression plasmid for GIP lentivirus packaging, GIP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to GIP/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002329
Gene Name GIP
Accession Number NM_004123
Gene ID 2695
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 462 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGTGGCCACGAAGACCTTTGCTCTGCTGCTGCTGTCCCTGTTCCTGGCAGTGGGACTAGGAGAGAAGAAAGAGGGTCACTTCAGCGCTCTCCCCTCCCTGCCTGTTGGATCTCATGCTAAGGTGAGCAGCCCTCAACCTCGAGGCCCCAGGTACGCGGAAGGGACTTTCATCAGTGACTACAGTATTGCCATGGACAAGATTCACCAACAAGACTTTGTGAACTGGCTGCTGGCCCAAAAGGGGAAGAAGAATGACTGGAAACACAACATCACCCAGAGGGAGGCTCGGGCGCTGGAGCTGGCCAGTCAAGCTAATAGGAAGGAGGAGGAGGCAGTGGAGCCACAGAGCTCCCCAGCCAAGAACCCCAGCGATGAAGATTTGCTGCGGGACTTGCTGATTCAAGAGCTGTTGGCCTGCTTGCTGGATCAGACAAACCTCTGCAGGCTCAGGTCTCGGTGA
ORF Protein Sequence MVATKTFALLLLSLFLAVGLGEKKEGHFSALPSLPVGSHAKVSSPQPRGPRYAEGTFISDYSIAMDKIHQQDFVNWLLAQKGKKNDWKHNITQREARALELASQANRKEEEAVEPQSSPAKNPSDEDLLRDLLIQELLACLLDQTNLCRLRSR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T11453-Ab Anti-GIP functional antibody
    Target Antigen GM-Tg-g-T11453-Ag GIP protein
    ORF Viral Vector pGMLP002329 Human GIP Lentivirus plasmid
    ORF Viral Vector vGMLP002329 Human GIP Lentivirus particle


    Target information

    Target ID GM-T11453
    Target Name GIP
    Gene ID 2695, 14607, 698335, 25040, 101080591, 100856162, 511073, 100069563
    Gene Symbol and Synonyms GIP,Gludins,RATGLUDINS
    Uniprot Accession P09681
    Uniprot Entry Name GIP_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000159224
    Target Classification Not Available

    This gene encodes an incretin hormone and belongs to the glucagon superfamily. The encoded protein is important in maintaining glucose homeostasis as it is a potent stimulator of insulin secretion from pancreatic beta-cells following food ingestion and nutrient absorption. This gene stimulates insulin secretion via its G protein-coupled receptor activation of adenylyl cyclase and other signal transduction pathways. It is a relatively poor inhibitor of gastric acid secretion. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.