Human TOR1B/DQ1 ORF/cDNA clone-Lentivirus plasmid (NM_014506)

Cat. No.: pGMLP002337
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TOR1B/DQ1 Lentiviral expression plasmid for TOR1B lentivirus packaging, TOR1B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to TOR1B/DQ1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $583.08
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002337
Gene Name TOR1B
Accession Number NM_014506
Gene ID 27348
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1011 bp
Gene Alias DQ1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTTGCGGGCTGGGTGGCTCCGGGGCGCGGCGGCGCTGGCGCTGCTGCTGGCGGCCCGAGTGGTGGCGGCGTTCGAGCCCATCACCGTGGGCCTAGCCATCGGGGCCGCGTCGGCCATCACCGGCTACCTGTCCTACAATGACATCTACTGCCGCTTCGCCGAGTGCTGCCGCGAGGAGCGGCCGCTCAACGCTTCGGCTCTCAAGCTGGATTTGGAGGAGAAGCTGTTTGGACAGCATCTAGCCACGGAAGTGATTTTCAAGGCGCTGACTGGCTTCAGGAACAACAAAAATCCCAAGAAACCACTGACCCTTTCCTTACACGGCTGGGCTGGCACAGGCAAGAATTTTGTCAGTCAAATTGTGGCTGAAAATCTTCACCCAAAAGGTCTGAAGAGTAACTTTGTCCACCTGTTTGTATCGACTCTGCACTTCCCTCATGAGCAGAAGATAAAACTGTACCAGGACCAGTTACAGAAGTGGATCCGCGGTAATGTGAGTGCATGTGCGAACTCTGTTTTCATATTTGACGAGATGGATAAATTGCACCCCGGGATCATTGACGCAATCAAGCCGTTTCTAGACTACTACGAGCAGGTTGACGGAGTGTCTTACCGCAAAGCCATCTTCATCTTTCTCAGCAATGCAGGCGGGGACCTTATAACTAAGACGGCTCTTGACTTTTGGCGGGCCGGAAGAAAGAGGGAAGACATTCAGCTGAAGGACCTGGAACCTGTACTGTCTGTCGGAGTCTTCAATAATAAACACAGTGGCCTGTGGCACAGTGGACTGATCGACAAAAACCTCATTGATTACTTTATCCCCTTCCTGCCTTTGGAGTACAGACATGTGAAAATGTGTGTGAGGGCCGAGATGAGGGCCCGTGGTTCTGCCATAGATGAAGACATTGTCACAAGAGTGGCAGAGGAAATGACGTTTTTCCCCAGAGACGAGAAAATCTACTCAGACAAGGGCTGCAAGACTGTGCAGTCGCGGCTGGATTTCCACTGA
ORF Protein Sequence MLRAGWLRGAAALALLLAARVVAAFEPITVGLAIGAASAITGYLSYNDIYCRFAECCREERPLNASALKLDLEEKLFGQHLATEVIFKALTGFRNNKNPKKPLTLSLHGWAGTGKNFVSQIVAENLHPKGLKSNFVHLFVSTLHFPHEQKIKLYQDQLQKWIRGNVSACANSVFIFDEMDKLHPGIIDAIKPFLDYYEQVDGVSYRKAIFIFLSNAGGDLITKTALDFWRAGRKREDIQLKDLEPVLSVGVFNNKHSGLWHSGLIDKNLIDYFIPFLPLEYRHVKMCVRAEMRARGSAIDEDIVTRVAEEMTFFPRDEKIYSDKGCKTVQSRLDFH

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0521-Ab Anti-TOR1B/ DQ1 functional antibody
    Target Antigen GM-Tg-g-SE0521-Ag TOR1B protein
    ORF Viral Vector pGMLP002337 Human TOR1B Lentivirus plasmid
    ORF Viral Vector vGMLP002337 Human TOR1B Lentivirus particle


    Target information

    Target ID GM-SE0521
    Target Name TOR1B
    Gene ID 27348, 30934, 716582, 311854, 101095776, 100855798, 533928, 100069929
    Gene Symbol and Synonyms 2610016F05Rik,DQ1,TOR1B,torsinB
    Uniprot Accession O14657
    Uniprot Entry Name TOR1B_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000136816
    Target Classification Not Available

    The protein encoded by this gene is an ATPase found primarily in the endoplasmic reticulum and nuclear envelope. This gene has a highly-similar neighboring gene, TOR1A, that encodes a protein that is likely to interact in a complex with this protein. Finally, this protein may act as a chaperone and play a role in maintaining the integrity of the nuclear envelope and endoplasmic reticulum. Several transcript variants, some protein-coding and others non-protein coding, have been found for this gene. [provided by RefSeq, Dec 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.