Human MYDGF/C19orf10/EUROIMAGE1875335 ORF/cDNA clone-Lentivirus plasmid (NM_019107)

Cat. No.: pGMLP002428
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MYDGF/C19orf10/EUROIMAGE1875335 Lentiviral expression plasmid for MYDGF lentivirus packaging, MYDGF lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to MYDGF/C19orf10 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $430.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002428
Gene Name MYDGF
Accession Number NM_019107
Gene ID 56005
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 522 bp
Gene Alias C19orf10,EUROIMAGE1875335,IL25,IL27,IL27w,R33729_1,SF20
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGGCGCCCAGCGGAGGGTGGAACGGCGTCGGCGCGAGCTTGTGGGCCGCGCTGCTCCTAGGGGCCGTGGCGCTGAGGCCGGCGGAGGCGGTGTCCGAGCCCACGACGGTGGCGTTTGACGTGCGGCCCGGCGGCGTCGTGCATTCCTTCTCCCATAACGTGGGCCCGGGGGACAAATATACGTGTATGTTCACTTACGCCTCTCAAGGAGGGACCAATGAGCAATGGCAGATGAGTCTGGGGACCAGCGAAGACCACCAGCACTTCACCTGCACCATCTGGAGGCCCCAGGGGAAGTCCTATCTGTACTTCACACAGTTCAAGGCAGAGGTGCGGGGCGCTGAGATTGAGTACGCCATGGCCTACTCTAAAGCCGCATTTGAAAGGGAAAGTGATGTCCCTCTGAAAACTGAGGAATTTGAAGTGACCAAAACAGCAGTGGCTCACAGGCCCGGGGCATTCAAAGCTGAGCTGTCCAAGCTGGTGATTGTGGCCAAGGCATCGCGCACTGAGCTGTGA
ORF Protein Sequence MAAPSGGWNGVGASLWAALLLGAVALRPAEAVSEPTTVAFDVRPGGVVHSFSHNVGPGDKYTCMFTYASQGGTNEQWQMSLGTSEDHQHFTCTIWRPQGKSYLYFTQFKAEVRGAEIEYAMAYSKAAFERESDVPLKTEEFEVTKTAVAHRPGAFKAELSKLVIVAKASRTEL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1116-Ab Anti-MYDGF/ C19orf10/ EUROIMAGE1875335 functional antibody
    Target Antigen GM-Tg-g-SE1116-Ag MYDGF protein
    ORF Viral Vector pGMLP002428 Human MYDGF Lentivirus plasmid
    ORF Viral Vector vGMLP002428 Human MYDGF Lentivirus particle


    Target information

    Target ID GM-SE1116
    Target Name MYDGF
    Gene ID 56005, 28106, 695477, 501282, 101091089, 611866, 407769, 100062552
    Gene Symbol and Synonyms C19H19orf10,C19orf10,C20H19orf10,C7H19orf10,CA2H19orf10,D17Wsu104e,EUROIMAGE1875335,IL25,IL27,IL27w,Ly6elg,MYDGF,R33729_1,SF20
    Uniprot Accession Q969H8
    Uniprot Entry Name MYDGF_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000074842
    Target Classification Not Available

    The protein encoded by this gene was previously thought to support proliferation of lymphoid cells and was considered an interleukin. However, this activity has not been reproducible and the function of this protein is currently unknown. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.