Human CAPG/AFCP/ HEL-S-66 ORF/cDNA clone-Lentivirus plasmid (NM_001747)
Pre-made Human CAPG/AFCP/ HEL-S-66 Lentiviral expression plasmid for CAPG lentivirus packaging, CAPG lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to CAPG/AFCP products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP002490 | Human CAPG Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP002490 |
Gene Name | CAPG |
Accession Number | NM_001747 |
Gene ID | 822 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1047 bp |
Gene Alias | AFCP, HEL-S-66, MCP |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTACACAGCCATTCCCCAGAGTGGCTCTCCATTCCCAGGCTCAGTGCAGGATCCAGGCCTGCATGTGTGGCGGGTGGAGAAGCTGAAGCCGGTGCCTGTGGCGCAAGAGAACCAGGGCGTCTTCTTCTCGGGGGACTCCTACCTAGTGCTGCACAATGGCCCAGAAGAGGTTTCCCATCTGCACCTGTGGATAGGCCAGCAGTCATCCCGGGATGAGCAGGGGGCCTGTGCCGTGCTGGCTGTGCACCTCAACACGCTGCTGGGAGAGCGGCCTGTGCAGCACCGCGAGGTGCAGGGCAATGAGTCTGACCTCTTCATGAGCTACTTCCCACGGGGCCTCAAGTACCAGGAAGGTGGTGTGGAGTCAGCATTTCACAAGACCTCCACAGGAGCCCCAGCTGCCATCAAGAAACTCTACCAGGTGAAGGGGAAGAAGAACATCCGTGCCACCGAGCGGGCACTGAACTGGGACAGCTTCAACACTGGGGACTGCTTCATCCTGGACCTGGGCCAGAACATCTTCGCCTGGTGTGGTGGAAAGTCCAACATCCTGGAACGCAACAAGGCGAGGGACCTGGCCCTGGCCATCCGGGACAGTGAGCGACAGGGCAAGGCCCAGGTGGAGATTGTCACTGATGGGGAGGAGCCTGCTGAGATGATCCAGGTCCTGGGCCCCAAGCCTGCTCTGAAGGAGGGCAACCCTGAGGAAGACCTCACAGCTGACAAGGCAAATGCCCAGGCCGCAGCTCTGTATAAGGTCTCTGATGCCACTGGACAGATGAACCTGACCAAGGTGGCTGACTCCAGCCCATTTGCCCTTGAACTGCTGATATCTGATGACTGCTTTGTGCTGGACAACGGGCTCTGTGGCAAGATCTATATCTGGAAGGGGCGAAAAGCGAATGAGAAGGAGCGGCAGGCAGCCCTGCAGGTGGCCGAGGGCTTCATCTCGCGCATGCAGTACGCCCCGAACACTCAGGTGGAGATTCTGCCTCAGGGCCATGAGAGTCCCATCTTCAAGCAATTTTTCAAGGACTGGAAATGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1406-Ab | Anti-CAPG/ AFCP/ HEL-S-66 functional antibody |
Target Antigen | GM-Tg-g-SE1406-Ag | CAPG protein |
ORF Viral Vector | pGMLP002490 | Human CAPG Lentivirus plasmid |
ORF Viral Vector | vGMLP002490 | Human CAPG Lentivirus particle |
Target information
Target ID | GM-SE1406 |
Target Name | CAPG |
Gene ID | 822, 12332, 695288, 297339, 101084952, 483082, 353121, 100053297 |
Gene Symbol and Synonyms | AFCP,CAPG,gCap39,HEL-S-66,mbh1,MCP |
Uniprot Accession | P40121 |
Uniprot Entry Name | CAPG_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000042493 |
Target Classification | Not Available |
This gene encodes a member of the gelsolin/villin family of actin-regulatory proteins. The encoded protein reversibly blocks the barbed ends of F-actin filaments in a Ca2+ and phosphoinositide-regulated manner, but does not sever preformed actin filaments. By capping the barbed ends of actin filaments, the encoded protein contributes to the control of actin-based motility in non-muscle cells. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jan 2012]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.