Human TSPAN31/SAS ORF/cDNA clone-Lentivirus plasmid (NM_005981)

Cat. No.: pGMLP002512
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TSPAN31/SAS Lentiviral expression plasmid for TSPAN31 lentivirus packaging, TSPAN31 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to TSPAN31/SAS products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $458.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002512
Gene Name TSPAN31
Accession Number NM_005981
Gene ID 6302
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 633 bp
Gene Alias SAS
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGTTTGTGGCGGCTTTGCCTGCTCCAAGAATGCGCTTTGCGCTCTCAACGTGGTCTACATGCTGGTGAGCTTGTTGCTCATTGGAGTGGCTGCTTGGGGCAAGGGCCTGGGTCTGGTGTCCAGCATCCACATCATCGGCGGAGTCATTGCTGTGGGAGTCTTCCTTCTCCTTATTGCAGTGGCTGGACTGGTGGGTGCTGTCAACCACCACCAAGTCCTGCTGTTCTTTTACATGATCATCCTTGGTTTGGTCTTCATCTTCCAATTTGTAATCTCTTGCTCATGTCTGGCTATTAACCGAAGCAAACAGACAGATGTCATCAATGCTTCTTGGTGGGTCATGAGCAACAAGACTCGGGATGAACTGGAAAGAAGTTTTGATTGTTGTGGCTTATTCAACCTCACAACCCTGTATCAACAAGATTATGATTTCTGCACTGCAATCTGCAAGAGCCAGAGCCCCACATGCCAGATGTGTGGAGAAAAGTTTCTTAAGCATTCAGACGAAGCCCTGAAAATCCTAGGGGGTGTTGGACTCTTCTTTAGCTTTACAGAGATCCTTGGTGTTTGGCTAGCAATGAGATTTCGGAATCAGAAGGATCCTAGAGCCAACCCCAGTGCCTTTCTATGA
ORF Protein Sequence MVCGGFACSKNALCALNVVYMLVSLLLIGVAAWGKGLGLVSSIHIIGGVIAVGVFLLLIAVAGLVGAVNHHQVLLFFYMIILGLVFIFQFVISCSCLAINRSKQTDVINASWWVMSNKTRDELERSFDCCGLFNLTTLYQQDYDFCTAICKSQSPTCQMCGEKFLKHSDEALKILGGVGLFFSFTEILGVWLAMRFRNQKDPRANPSAFL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2192-Ab Anti-TSPAN31 monoclonal antibody
    Target Antigen GM-Tg-g-IP2192-Ag TSPAN31 protein
    ORF Viral Vector pGMLP002512 Human TSPAN31 Lentivirus plasmid
    ORF Viral Vector vGMLP002512 Human TSPAN31 Lentivirus particle


    Target information

    Target ID GM-IP2192
    Target Name TSPAN31
    Gene ID 6302, 67125, 715700, 362890, 101097655, 403676, 510619, 100050928
    Gene Symbol and Synonyms 2700085A14Rik,SAS,TSPAN31
    Uniprot Accession Q12999
    Uniprot Entry Name TSN31_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000135452
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is thought to be involved in growth-related cellular processes. This gene is associated with tumorigenesis and osteosarcoma. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.