Human TMED4/ERS25/GMP25iso ORF/cDNA clone-Lentivirus plasmid (NM_182547)

Cat. No.: pGMLP002599
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TMED4/ERS25/GMP25iso Lentiviral expression plasmid for TMED4 lentivirus packaging, TMED4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to TMED4/ERS25 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $471
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002599
Gene Name TMED4
Accession Number NM_182547
Gene ID 222068
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 684 bp
Gene Alias ERS25,GMP25iso,HNLF,p24a3,p24alpha3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCAGGTGTCGGGGCTGGGCCTCTGCGGGCGATGGGGCGGCAGGCCCTGCTGCTTCTCGCGCTGTGCGCCACAGGCGCCCAGGGGCTCTACTTCCACATCGGCGAGACCGAGAAGCGCTGTTTCATCGAGGAAATCCCCGACGAGACCATGGTCATCGGCAACTATCGTACCCAGATGTGGGATAAGCAGAAGGAGGTCTTCCTGCCCTCGACCCCTGGCCTGGGCATGCACGTGGAAGTGAAGGACCCCGACGGCAAGGTGGTGCTGTCCCGGCAGTACGGCTCGGAGGGCCGCTTCACGTTCACCTCCCACACGCCCGGTGACCATCAAATCTGTCTGCACTCCAATTCTACCAGGATGGCTCTCTTCGCTGGTGGCAAACTGCGGGTGCATCTCGACATCCAGGTTGGGGAGCATGCCAACAACTACCCTGAGATTGCTGCAAAAGATAAGCTGACGGAGCTACAGCTCCGCGCCCGCCAGTTGCTTGATCAGGTGGAACAGATTCAGAAGGAGCAGGATTACCAAAGGTATCGTGAAGAGCGCTTCCGACTGACGAGCGAGAGCACCAACCAGAGGGTCCTATGGTGGTCCATTGCTCAGACTGTCATCCTCATCCTCACTGGCATCTGGCAGATGCGTCACCTCAAGAGCTTCTTTGAGGCCAAGAAGCTGGTGTAG
ORF Protein Sequence MAGVGAGPLRAMGRQALLLLALCATGAQGLYFHIGETEKRCFIEEIPDETMVIGNYRTQMWDKQKEVFLPSTPGLGMHVEVKDPDGKVVLSRQYGSEGRFTFTSHTPGDHQICLHSNSTRMALFAGGKLRVHLDIQVGEHANNYPEIAAKDKLTELQLRARQLLDQVEQIQKEQDYQRYREERFRLTSESTNQRVLWWSIAQTVILILTGIWQMRHLKSFFEAKKLV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0509-Ab Anti-TMED4/ ERS25/ GMP25iso functional antibody
    Target Antigen GM-Tg-g-SE0509-Ag TMED4 protein
    ORF Viral Vector pGMLP002599 Human TMED4 Lentivirus plasmid
    ORF Viral Vector vGMLP002599 Human TMED4 Lentivirus particle


    Target information

    Target ID GM-SE0509
    Target Name TMED4
    Gene ID 222068, 103694, 699105, 305502, 101095809, 475498, 508729, 100065195
    Gene Symbol and Synonyms 1110014L17Rik,ERS25,GMP25iso,HNLF,p24a3,p24alpha3,RGD1306319,TMED4
    Uniprot Accession Q7Z7H5
    Uniprot Entry Name TMED4_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000158604
    Target Classification Not Available

    Involved in positive regulation of I-kappaB kinase/NF-kappaB signaling. Predicted to be located in endoplasmic reticulum membrane. Predicted to be integral component of membrane. Predicted to be active in several cellular components, including COPII-coated ER to Golgi transport vesicle; Golgi apparatus; and endoplasmic reticulum-Golgi intermediate compartment. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.