Human ABHD10 ORF/cDNA clone-Lentivirus plasmid (NM_018394)

Pre-made Human ABHD10/ Lentiviral expression plasmid for ABHD10 lentivirus packaging, ABHD10 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to ABHD10/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002614 Human ABHD10 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002614
Gene Name ABHD10
Accession Number NM_018394
Gene ID 55347
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 921 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCGGTTGCGCGCTTGGCAGCTGTGGCGGCCTGGGTACCTTGTCGGAGCTGGGGCTGGGCAGCCGTCCCCTTCGGTCCCCACCGTGGCCTCAGCGTGCTGCTTGCACGGATACCTCAGCGGGCGCCACGGTGGCTCCCAGCTTGTAGACAAAAGACGTCACTCTCATTCCTTAATCGACCAGACCTTCCAAACCTGGCTTATAAGAAGCTAAAAGGCAAAAGTCCAGGAATTATCTTCATCCCTGGCTATCTTTCTTATATGAATGGTACAAAAGCGTTGGCGATTGAGGAGTTTTGCAAATCTCTAGGTCACGCCTGCATAAGGTTTGATTACTCAGGAGTTGGAAGTTCAGATGGTAACTCAGAGGAAAGCACACTGGGGAAATGGAGAAAAGATGTTCTTTCTATAATTGATGACTTAGCTGATGGGCCACAGATTCTTGTTGGATCTAGCCTTGGAGGGTGGCTTATGCTTCATGCTGCAATTGCACGACCAGAGAAGGTCGTGGCTCTTATTGGTGTAGCTACAGCTGCAGATACCTTAGTGACAAAGTTTAATCAGCTTCCTGTTGAGCTAAAAAAGGAAGTAGAGATGAAAGGTGTGTGGAGCATGCCATCAAAATACTCTGAAGAAGGAGTTTATAACGTTCAGTACAGTTTCATTAAAGAAGCTGAACATCACTGCTTGTTACATAGCCCAATTCCTGTGAACTGCCCCATAAGATTGCTCCATGGCATGAAGGATGACATTGTACCTTGGCATACATCAATGCAGGTTGCCGATCGAGTACTCAGCACAGATGTGGATGTCATCCTCCGAAAACACAGTGATCACCGAATGAGGGAAAAAGCAGACATTCAACTTCTTGTTTACACTATTGATGACTTAATTGATAAGCTCTCAACTATAGTTAACTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1528-Ab Anti-ABHDA/ ABHD10 functional antibody
    Target Antigen GM-Tg-g-SE1528-Ag ABHD10 protein
    ORF Viral Vector pGMLP002614 Human ABHD10 Lentivirus plasmid
    ORF Viral Vector vGMLP002614 Human ABHD10 Lentivirus particle


    Target information

    Target ID GM-SE1528
    Target Name ABHD10
    Gene ID 55347, 213012, 707464, 303953, 101086743, 478561, 515563, 100071551
    Gene Symbol and Synonyms ABHD10,RGD1308084
    Uniprot Accession Q9NUJ1
    Uniprot Entry Name ABHDA_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000144827
    Target Classification Not Available

    This gene encodes a mitochondrially-localized enzyme that acts in liver cells as a hydrolase. The encoded protein removes glucuronide from mycophenolic acid acyl-glucuronide. There is a pseudogene for this gene on chromosome 6. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.