Human SFTPA2/COLEC5/ PSAP ORF/cDNA clone-Lentivirus plasmid (NM_001320814)
Pre-made Human SFTPA2/COLEC5/ PSAP Lentiviral expression plasmid for SFTPA2 lentivirus packaging, SFTPA2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to SFTPA2/COLEC5 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP002640 | Human SFTPA2 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP002640 |
Gene Name | SFTPA2 |
Accession Number | NM_001320814 |
Gene ID | 729238 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 777 bp |
Gene Alias | COLEC5, PSAP, PSP-A, PSPA, SFTP1, SFTPA2B, SP-2A, SP-A, SPA2, SPAII |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCCAGGAGCAGCGACTGGACCCAGAGCCATGTGGCTGTGCCCTCTGGCCCTCACCCTCATCTTGATGGCAGCCTCTGGTGCTGCGTGCGAAGTGAAGGACGTTTGTGTTGGAAGCCCTGGTATCCCCGGCACTCCTGGATCCCACGGCCTGCCAGGCAGGGACGGGAGAGATGGTGTCAAAGGAGACCCTGGCCCTCCAGGCCCCATGGGTCCGCCTGGAGAAACACCATGTCCTCCTGGGAATAATGGGCTGCCTGGAGCCCCTGGTGTCCCTGGAGAGCGTGGAGAGAAGGGGGAGGCTGGCGAGAGAGGCCCTCCAGGGCTTCCAGCTCATCTAGATGAGGAGCTCCAAGCCACACTCCACGACTTCAGACATCAAATCCTGCAGACAAGGGGAGCCCTCAGTCTGCAGGGCTCCATAATGACAGTAGGAGAGAAGGTCTTCTCCAGCAATGGGCAGTCCATCACTTTTGATGCCATTCAGGAGGCATGTGCCAGAGCAGGCGGCCGCATTGCTGTCCCAAGGAATCCAGAGGAAAATGAGGCCATTGCAAGCTTCGTGAAGAAGTACAACACATATGCCTATGTAGGCCTGACTGAGGGTCCCAGCCCTGGAGACTTCCGCTACTCAGATGGGACCCCTGTAAACTACACCAACTGGTACCGAGGGGAGCCTGCAGGTCGGGGAAAAGAGCAGTGTGTGGAGATGTACACAGATGGGCAGTGGAATGACAGGAACTGCCTGTACTCCCGACTGACCATCTGTGAGTTCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1288-Ab | Anti-SFPA2/ SFTPA2/ COLEC5 functional antibody |
Target Antigen | GM-Tg-g-SE1288-Ag | SFTPA2 protein |
ORF Viral Vector | pGMLP002640 | Human SFTPA2 Lentivirus plasmid |
ORF Viral Vector | vGMLP002640 | Human SFTPA2 Lentivirus particle |
Target information
Target ID | GM-SE1288 |
Target Name | SFTPA2 |
Gene ID | 729238 |
Gene Symbol and Synonyms | COLEC5,ILD2,PSAP,PSP-A,PSPA,SFTP1,SFTPA2,SFTPA2B,SP-2A,SP-A,SPA2,SPAII |
Uniprot Accession | Q8IWL1 |
Uniprot Entry Name | SFPA2_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000185303 |
Target Classification | Not Available |
This gene is one of several genes encoding pulmonary-surfactant associated proteins (SFTPA) located on chromosome 10. Mutations in this gene and a highly similar gene located nearby, which affect the highly conserved carbohydrate recognition domain, are associated with idiopathic pulmonary fibrosis. The current version of the assembly displays only a single centromeric SFTPA gene pair rather than the two gene pairs shown in the previous assembly which were thought to have resulted from a duplication. [provided by RefSeq, Sep 2009]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.