Human SFTPA2/COLEC5/ PSAP ORF/cDNA clone-Lentivirus plasmid (NM_001320814)

Pre-made Human SFTPA2/COLEC5/ PSAP Lentiviral expression plasmid for SFTPA2 lentivirus packaging, SFTPA2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to SFTPA2/COLEC5 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002640 Human SFTPA2 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002640
Gene Name SFTPA2
Accession Number NM_001320814
Gene ID 729238
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 777 bp
Gene Alias COLEC5, PSAP, PSP-A, PSPA, SFTP1, SFTPA2B, SP-2A, SP-A, SPA2, SPAII
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCCAGGAGCAGCGACTGGACCCAGAGCCATGTGGCTGTGCCCTCTGGCCCTCACCCTCATCTTGATGGCAGCCTCTGGTGCTGCGTGCGAAGTGAAGGACGTTTGTGTTGGAAGCCCTGGTATCCCCGGCACTCCTGGATCCCACGGCCTGCCAGGCAGGGACGGGAGAGATGGTGTCAAAGGAGACCCTGGCCCTCCAGGCCCCATGGGTCCGCCTGGAGAAACACCATGTCCTCCTGGGAATAATGGGCTGCCTGGAGCCCCTGGTGTCCCTGGAGAGCGTGGAGAGAAGGGGGAGGCTGGCGAGAGAGGCCCTCCAGGGCTTCCAGCTCATCTAGATGAGGAGCTCCAAGCCACACTCCACGACTTCAGACATCAAATCCTGCAGACAAGGGGAGCCCTCAGTCTGCAGGGCTCCATAATGACAGTAGGAGAGAAGGTCTTCTCCAGCAATGGGCAGTCCATCACTTTTGATGCCATTCAGGAGGCATGTGCCAGAGCAGGCGGCCGCATTGCTGTCCCAAGGAATCCAGAGGAAAATGAGGCCATTGCAAGCTTCGTGAAGAAGTACAACACATATGCCTATGTAGGCCTGACTGAGGGTCCCAGCCCTGGAGACTTCCGCTACTCAGATGGGACCCCTGTAAACTACACCAACTGGTACCGAGGGGAGCCTGCAGGTCGGGGAAAAGAGCAGTGTGTGGAGATGTACACAGATGGGCAGTGGAATGACAGGAACTGCCTGTACTCCCGACTGACCATCTGTGAGTTCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1288-Ab Anti-SFPA2/ SFTPA2/ COLEC5 functional antibody
    Target Antigen GM-Tg-g-SE1288-Ag SFTPA2 protein
    ORF Viral Vector pGMLP002640 Human SFTPA2 Lentivirus plasmid
    ORF Viral Vector vGMLP002640 Human SFTPA2 Lentivirus particle


    Target information

    Target ID GM-SE1288
    Target Name SFTPA2
    Gene ID 729238
    Gene Symbol and Synonyms COLEC5,ILD2,PSAP,PSP-A,PSPA,SFTP1,SFTPA2,SFTPA2B,SP-2A,SP-A,SPA2,SPAII
    Uniprot Accession Q8IWL1
    Uniprot Entry Name SFPA2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000185303
    Target Classification Not Available

    This gene is one of several genes encoding pulmonary-surfactant associated proteins (SFTPA) located on chromosome 10. Mutations in this gene and a highly similar gene located nearby, which affect the highly conserved carbohydrate recognition domain, are associated with idiopathic pulmonary fibrosis. The current version of the assembly displays only a single centromeric SFTPA gene pair rather than the two gene pairs shown in the previous assembly which were thought to have resulted from a duplication. [provided by RefSeq, Sep 2009]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.