Human DEK/D6S231E ORF/cDNA clone-Lentivirus plasmid (NM_003472)
Cat. No.: pGMLP002669
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human DEK/D6S231E Lentiviral expression plasmid for DEK lentivirus packaging, DEK lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
DEK/D6S231E products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP002669 |
Gene Name | DEK |
Accession Number | NM_003472 |
Gene ID | 7913 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1128 bp |
Gene Alias | D6S231E |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGTCCGCCTCGGCCCCTGCTGCGGAGGGGGAGGGAACCCCCACCCAGCCCGCGTCCGAGAAAGAACCCGAAATGCCCGGTCCCAGAGAGGAGAGCGAGGAGGAAGAGGACGAGGACGACGAGGAGGAGGAGGAGGAGGAAAAAGAAAAGAGTCTCATCGTGGAAGGCAAGAGGGAAAAGAAAAAAGTAGAGAGGTTGACAATGCAAGTCTCTTCCTTACAGAGAGAGCCATTTACAATTGCACAAGGAAAGGGGCAGAAACTTTGTGAAATTGAGAGGATACATTTTTTTCTAAGTAAGAAGAAAACCGATGAACTTAGAAATCTACACAAACTGCTTTACAACAGGCCAGGCACTGTGTCCTCATTAAAGAAGAATGTGGGTCAGTTCAGTGGCTTTCCATTTGAAAAAGGAAGTGTCCAATATAAAAAGAAGGAAGAAATGTTGAAAAAATTTAGAAATGCCATGTTAAAGAGCATCTGTGAGGTTCTTGATTTGGAGAGATCAGGTGTAAATAGTGAACTAGTGAAGAGGATCTTGAATTTCTTAATGCATCCAAAGCCTTCTGGCAAACCATTGCCGAAATCTAAAAAAACTTGTAGCAAAGGCAGTAAAAAGGAACGGAACAGTTCTGGAATGGCAAGGAAGGCTAAGCGAACCAAATGTCCTGAAATTCTGTCAGATGAATCTAGTAGTGATGAAGATGAAAAGAAAAACAAGGAAGAGTCTTCAGATGATGAAGATAAAGAAAGTGAAGAGGAGCCACCAAAAAAGACAGCCAAAAGAGAAAAACCTAAACAGAAAGCTACTTCTAAAAGTAAAAAATCTGTGAAAAGTGCCAATGTTAAGAAAGCAGATAGCAGCACCACCAAGAAGAATCAAAACAGTTCCAAAAAAGAAAGTGAGTCTGAGGATAGTTCAGATGATGAACCTTTAATTAAAAAGTTGAAGAAACCCCCTACAGATGAAGAGTTAAAGGAAACAATAAAGAAATTACTGGCCAGTGCTAACTTGGAAGAAGTCACAATGAAACAGATTTGCAAAAAGGTCTATGAAAATTATCCTACTTATGATTTAACTGAAAGAAAAGATTTCATAAAAACAACTGTAAAAGAGCTAATTTCTTGA |
ORF Protein Sequence | MSASAPAAEGEGTPTQPASEKEPEMPGPREESEEEEDEDDEEEEEEEKEKSLIVEGKREKKKVERLTMQVSSLQREPFTIAQGKGQKLCEIERIHFFLSKKKTDELRNLHKLLYNRPGTVSSLKKNVGQFSGFPFEKGSVQYKKKEEMLKKFRNAMLKSICEVLDLERSGVNSELVKRILNFLMHPKPSGKPLPKSKKTCSKGSKKERNSSGMARKAKRTKCPEILSDESSSDEDEKKNKEESSDDEDKESEEEPPKKTAKREKPKQKATSKSKKSVKSANVKKADSSTTKKNQNSSKKESESEDSSDDEPLIKKLKKPPTDEELKETIKKLLASANLEEVTMKQICKKVYENYPTYDLTERKDFIKTTVKELIS |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T28758-Ab | Anti-DEK monoclonal antibody |
Target Antigen | GM-Tg-g-T28758-Ag | DEK protein |
ORF Viral Vector | pGMLP002669 | Human DEK Lentivirus plasmid |
ORF Viral Vector | pGMPC001418 | Human DEK Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLP002669 | Human DEK Lentivirus particle |
Target information
Target ID | GM-T28758 |
Target Name | DEK |
Gene ID | 7913, 110052, 712460, 306817, 101090769, 610538, 540945, 100066265 |
Gene Symbol and Synonyms | 1810019E15Rik,D13H6S231E,D6S231E,DEK |
Uniprot Accession | P35659 |
Uniprot Entry Name | DEK_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000124795 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a protein with one SAP domain. This protein binds to cruciform and superhelical DNA and induces positive supercoils into closed circular DNA, and is also involved in splice site selection during mRNA processing. Chromosomal aberrations involving this region, increased expression of this gene, and the presence of antibodies against this protein are all associated with various diseases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.