Human APCS/HEL-S-92n/PTX2 ORF/cDNA clone-Lentivirus plasmid (NM_001639)

Cat. No.: pGMLP002714
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human APCS/HEL-S-92n/PTX2 Lentiviral expression plasmid for APCS lentivirus packaging, APCS lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to APCS/HEL-S-92n products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $468
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002714
Gene Name APCS
Accession Number NM_001639
Gene ID 325
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 672 bp
Gene Alias HEL-S-92n,PTX2,SAP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAACAAGCCGCTGCTTTGGATCTCTGTCCTCACCAGCCTCCTGGAAGCCTTTGCTCACACAGACCTCAGTGGGAAGGTGTTTGTATTTCCTAGAGAATCTGTTACTGATCATGTAAACTTGATCACACCGCTGGAGAAGCCTCTACAGAACTTTACCTTGTGTTTTCGAGCCTATAGTGATCTCTCTCGTGCCTACAGCCTCTTCTCCTACAATACCCAAGGCAGGGATAATGAGCTACTAGTTTATAAAGAAAGAGTTGGAGAGTATAGTCTATACATTGGAAGACACAAAGTTACATCCAAAGTTATCGAAAAGTTCCCGGCTCCAGTGCACATCTGTGTGAGCTGGGAGTCCTCATCAGGTATTGCTGAATTTTGGATCAATGGGACACCTTTGGTGAAAAAGGGTCTGCGACAGGGTTACTTTGTAGAAGCTCAGCCCAAGATTGTCCTGGGGCAGGAACAGGATTCCTATGGGGGCAAGTTTGATAGGAGCCAGTCCTTTGTGGGAGAGATTGGGGATTTGTACATGTGGGACTCTGTGCTGCCCCCAGAAAATATCCTGTCTGCCTATCAGGGTACCCCTCTCCCTGCCAATATCCTGGACTGGCAGGCTCTGAACTATGAAATCAGAGGATATGTCATCATCAAACCCTTGGTGTGGGTCTGA
ORF Protein Sequence MNKPLLWISVLTSLLEAFAHTDLSGKVFVFPRESVTDHVNLITPLEKPLQNFTLCFRAYSDLSRAYSLFSYNTQGRDNELLVYKERVGEYSLYIGRHKVTSKVIEKFPAPVHICVSWESSSGIAEFWINGTPLVKKGLRQGYFVEAQPKIVLGQEQDSYGGKFDRSQSFVGEIGDLYMWDSVLPPENILSAYQGTPLPANILDWQALNYEIRGYVIIKPLVWV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-144 Pre-Made Dezamizumab biosimilar, Whole mAb, Anti-APCS Antibody: Anti-HEL-S-92n/PTX2/SAP therapeutic antibody
    Target Antibody GM-Tg-g-T37742-Ab Anti-SAMP/ APCS/ HEL-S-92n functional antibody
    Target Antigen GM-Tg-g-T37742-Ag APCS protein
    ORF Viral Vector pGMLP002714 Human APCS Lentivirus plasmid
    ORF Viral Vector vGMLP002714 Human APCS Lentivirus particle


    Target information

    Target ID GM-T37742
    Target Name APCS
    Gene ID 325, 20219, 719421, 29339, 101093332, 514488, 100053475
    Gene Symbol and Synonyms APCS,HEL-S-92n,PTX2,SAP
    Uniprot Accession P02743
    Uniprot Entry Name SAMP_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, INN Index
    Disease Ovary Cancer, Other diseases of intestines (K55-K64)
    Gene Ensembl ENSG00000132703
    Target Classification Not Available

    The protein encoded by this gene is a glycoprotein, belonging to the pentraxin family of proteins, which has a characteristic pentameric organization. These family members have considerable sequence homology which is thought to be the result of gene duplication. The binding of the encoded protein to proteins in the pathological amyloid cross-beta fold suggests its possible role as a chaperone. This protein is also thought to control the degradation of chromatin. It has been demonstrated that this protein binds to apoptotic cells at an early stage, which raises the possibility that it is involved in dealing with apoptotic cells in vivo. [provided by RefSeq, Sep 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.