Human DEPTOR/DEP.6/DEPDC6 ORF/cDNA clone-Lentivirus plasmid (NM_001283012)

Cat. No.: pGMLP002889
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human DEPTOR/DEP.6/DEPDC6 Lentiviral expression plasmid for DEPTOR lentivirus packaging, DEPTOR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to DEPTOR/DEP.6 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $531.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002889
Gene Name DEPTOR
Accession Number NM_001283012
Gene ID 64798
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 927 bp
Gene Alias DEP.6,DEPDC6
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGGAGGGCGGCAGCACTGGCAGTGCTGGCAGTGACAGCAGCACCAGCGGGAGTGGCGGGGCGCAGCAAAGGGAGCTGGAGCGCATGGCTGAGGTCTTGGTCACCGGGGAACAGCTACGGCTGATGAGCCCTGAAAACACACTCCTGCAGCCCAGGGAGGAGGAAGGGGTCAAGTATGAGCGCACCTTCATGGCATCTGAATTCCTGGACTGGCTGGTTCAGGAAGGTGAGGCCACCACGAGGAAAGAGGCAGAGCAGCTTTGCCACCGGCTTATGGAGCATGGCATCATCCAGCATGTGTCCAACAAGCACCCATTTGTGGACAGCAATCTTCTCTACCAGTTCAGAATGAACTTCCGGCGGAGGCGAAGACTGATGGAGCTGCTCAATGAAAAGTCCCCCTCCTCCCAGGAAACTCATGACAGTCCCTTCTGCCTGAGGAAGCAGAGCCATGACAATCGGAAATCTACCAGCTTTATGTCAGTGAGCCCCAGCAAGGAGATCAAGATCGTGTCTGCAGTGAGGAGAAGCAGCATGAGCAGCTGTGGCAGCAGCGGCTACTTCAGCAGCAGCCCCACCCTCAGCAGCAGCCCCCCTGTGCTCTGCAACCCCAAGTCCGTGCTGAAGAGACCTGTCACCTCTGAGGAACTCCTTACTCCCGGGGCTCCGTATGCAAGGAAGACATTCACGATTGTTGGTGACGCGGTTGGCTGGGGTTTTGTGGTGCGAGGAAGTAAGCCATGCCACATCCAGGCTGTAGACCCCAGTGGCCCTGCAGCCGCAGCAGGAATGAAGGTCTGTCAGTTTGTCGTCTCTGTCAACGGGCTCAATGTCCTGCATGTAGACTACCGGACCGTGAGCAATCTGATTCTGACGGGCCCACGGACGATTGTCATGGAAGTCATGGAGGAGTTAGAGTGCTGA
ORF Protein Sequence MEEGGSTGSAGSDSSTSGSGGAQQRELERMAEVLVTGEQLRLMSPENTLLQPREEEGVKYERTFMASEFLDWLVQEGEATTRKEAEQLCHRLMEHGIIQHVSNKHPFVDSNLLYQFRMNFRRRRRLMELLNEKSPSSQETHDSPFCLRKQSHDNRKSTSFMSVSPSKEIKIVSAVRRSSMSSCGSSGYFSSSPTLSSSPPVLCNPKSVLKRPVTSEELLTPGAPYARKTFTIVGDAVGWGFVVRGSKPCHIQAVDPSGPAAAAGMKVCQFVVSVNGLNVLHVDYRTVSNLILTGPRTIVMEVMEELEC

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T96301-Ab Anti-DEPTOR monoclonal antibody
    Target Antigen GM-Tg-g-T96301-Ag DEPTOR protein
    ORF Viral Vector pGMLP002889 Human DEPTOR Lentivirus plasmid
    ORF Viral Vector pGMLV002217 Human DEPTOR Lentivirus plasmid
    ORF Viral Vector vGMLP002889 Human DEPTOR Lentivirus particle
    ORF Viral Vector vGMLV002217 Human DEPTOR Lentivirus particle


    Target information

    Target ID GM-T96301
    Target Name DEPTOR
    Gene ID 64798, 97998, 702649, 314979, 101098686, 482028, 617606, 100057185
    Gene Symbol and Synonyms DEP.6,DEPDC6,DEPTOR,RGD1561030
    Uniprot Accession Q8TB45
    Uniprot Entry Name DPTOR_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000155792
    Target Classification Not Available

    Involved in several processes, including negative regulation of TOR signaling; negative regulation of cell size; and negative regulation of protein kinase activity. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.