Human A4GALT/A14GALT/A4GALT1 ORF/cDNA clone-Lentivirus plasmid (NM_017436)

Cat. No.: pGMLP002906
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human A4GALT/A14GALT/A4GALT1 Lentiviral expression plasmid for A4GALT lentivirus packaging, A4GALT lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to A4GALT/A14GALT products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $597.36
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002906
Gene Name A4GALT
Accession Number NM_017436
Gene ID 53947
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1062 bp
Gene Alias A14GALT,A4GALT1,Gb3S,P(k),P1,P1PK,PK
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCCAAGCCCCCCGACCTCCTGCTGCGGCTGCTCCGGGGCGCCCCAAGGCAGCGGGTCTGCACCCTGTTCATCATCGGCTTCAAGTTCACGTTTTTCGTCTCCATCATGATCTACTGGCACGTTGTGGGAGAGCCCAAGGAGAAAGGGCAGCTCTATAACCTGCCAGCAGAGATCCCCTGCCCCACCTTGACACCCCCCACCCCACCCTCCCACGGCCCCACTCCAGGCAACATCTTCTTCCTGGAGACTTCAGACCGGACCAACCCCAACTTCCTGTTCATGTGCTCGGTGGAGTCGGCCGCCAGAACTCACCCCGAATCCCACGTGCTGGTCCTGATGAAAGGGCTTCCGGGTGGCAACGCCTCTCTGCCCCGGCACCTGGGCATCTCACTTCTGAGCTGCTTCCCGAATGTCCAGATGCTCCCGCTGGACCTGCGGGAGCTGTTCCGGGACACACCCCTGGCCGACTGGTACGCGGCCGTGCAGGGGCGCTGGGAGCCCTACCTGCTGCCCGTGCTCTCCGACGCCTCCAGGATCGCACTCATGTGGAAGTTCGGCGGCATCTACCTGGACACGGACTTCATTGTTCTCAAGAACCTGCGGAACCTGACCAACGTGCTGGGCACCCAGTCCCGCTACGTCCTCAACGGCGCGTTCCTGGCCTTCGAGCGCCGGCACGAGTTCATGGCGCTGTGCATGCGGGACTTCGTGGACCACTACAACGGCTGGATCTGGGGTCACCAGGGCCCGCAGCTGCTCACGCGGGTCTTCAAGAAGTGGTGTTCCATCCGCAGCCTGGCCGAGAGCCGCGCCTGCCGCGGCGTCACCACCCTGCCCCCTGAGGCCTTCTACCCCATCCCCTGGCAGGACTGGAAGAAGTACTTTGAGGACATCAACCCCGAGGAGCTGCCGCGGCTGCTCAGTGCCACCTATGCTGTCCACGTGTGGAACAAGAAGAGCCAGGGCACGCGGTTCGAGGCCACGTCCAGGGCACTGCTGGCCCAGCTGCATGCCCGCTACTGCCCCACGACGCACGAGGCCATGAAAATGTACTTGTGA
ORF Protein Sequence MSKPPDLLLRLLRGAPRQRVCTLFIIGFKFTFFVSIMIYWHVVGEPKEKGQLYNLPAEIPCPTLTPPTPPSHGPTPGNIFFLETSDRTNPNFLFMCSVESAARTHPESHVLVLMKGLPGGNASLPRHLGISLLSCFPNVQMLPLDLRELFRDTPLADWYAAVQGRWEPYLLPVLSDASRIALMWKFGGIYLDTDFIVLKNLRNLTNVLGTQSRYVLNGAFLAFERRHEFMALCMRDFVDHYNGWIWGHQGPQLLTRVFKKWCSIRSLAESRACRGVTTLPPEAFYPIPWQDWKKYFEDINPEELPRLLSATYAVHVWNKKSQGTRFEATSRALLAQLHARYCPTTHEAMKMYL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0268-Ab Anti-A4GALT monoclonal antibody
    Target Antigen GM-Tg-g-IP0268-Ag A4GALT protein
    ORF Viral Vector pGMLP002906 Human A4GALT Lentivirus plasmid
    ORF Viral Vector vGMLP002906 Human A4GALT Lentivirus particle


    Target information

    Target ID GM-IP0268
    Target Name A4GALT
    Gene ID 53947, 239559, 710998, 63888, 101085732, 481222, 618369, 102150730
    Gene Symbol and Synonyms A14GALT,A4GALT,A4GALT1,Gb3,Gb3S,P(k),P1,P1PK,PK
    Uniprot Accession Q9NPC4
    Uniprot Entry Name A4GAT_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000128274
    Target Classification Not Available

    The protein encoded by this gene catalyzes the transfer of galactose to lactosylceramide to form globotriaosylceramide, which has been identified as the P(k) antigen of the P blood group system. This protein, a type II membrane protein found in the Golgi, is also required for the synthesis of the bacterial verotoxins receptor. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.