Human BMP15/GDF9B/ODG2 ORF/cDNA clone-Lentivirus plasmid (NM_005448)

Cat. No.: pGMLP002908
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human BMP15/GDF9B/ODG2 Lentiviral expression plasmid for BMP15 lentivirus packaging, BMP15 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to BMP15/GDF9B products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $630.12
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002908
Gene Name BMP15
Accession Number NM_005448
Gene ID 9210
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1179 bp
Gene Alias GDF9B,ODG2,POF4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGTCCTCCTCAGTATTCTTAGAATTCTTTTTCTTTGTGAACTCGTGCTTTTCATGGAACACAGGGCCCAAATGGCAGAAGGAGGGCAGTCCTCTATTGCCCTTCTGGCTGAGGCCCCTACTTTGCCCCTGATTGAGGAGCTGCTAGAAGAATCCCCTGGCGAACAGCCAAGGAAGCCCCGGCTCCTAGGGCATTCACTGCGGTACATGCTGGAGTTGTACCGGCGTTCAGCTGACTCGCATGGGCACCCTAGAGAGAACCGCACCATTGGGGCCACCATGGTGAGGCTGGTGAAGCCCTTGACCAATGTGGCAAGGCCTCACAGAGGTACCTGGCATATACAGATCCTGGGCTTTCCTCTCAGACCAAACCGAGGACTATACCAACTAGTTAGAGCCACTGTGGTTTACCGCCATCATCTCCAACTAACTCGCTTCAATCTCTCCTGCCATGTGGAGCCCTGGGTGCAGAAAAACCCAACCAACCACTTCCCTTCCTCAGAAGGAGATTCCTCAAAACCTTCCCTGATGTCTAACGCTTGGAAAGAGATGGATATCACACAACTTGTTCAGCAAAGGTTCTGGAATAACAAGGGACACAGGATCCTACGACTCCGTTTTATGTGTCAGCAGCAAAAAGATAGTGGTGGTCTTGAGCTCTGGCATGGCACTTCATCCTTGGACATTGCCTTCTTGTTACTCTATTTCAATGATACTCATAAAAGCATTCGGAAGGCTAAATTTCTTCCCAGGGGCATGGAGGAGTTCATGGAAAGGGAATCTCTTCTCCGGAGAACCCGACAAGCAGATGGTATCTCAGCTGAGGTTACTGCCTCTTCCTCAAAACATAGCGGGCCTGAAAATAACCAGTGTTCCCTCCACCCTTTCCAAATCAGCTTCCGCCAGCTGGGTTGGGATCACTGGATCATTGCTCCCCCTTTCTACACCCCAAACTACTGTAAAGGAACTTGTCTCCGAGTACTACGCGATGGTCTCAATTCCCCCAATCACGCCATTATTCAGAACCTTATCAATCAGTTGGTGGACCAGAGTGTCCCCCGGCCCTCCTGTGTCCCGTATAAGTATGTTCCAATTAGTGTCCTTATGATTGAGGCAAATGGGAGTATTTTGTACAAGGAGTATGAGGGTATGATTGCTGAGTCTTGTACATGCAGATGA
ORF Protein Sequence MVLLSILRILFLCELVLFMEHRAQMAEGGQSSIALLAEAPTLPLIEELLEESPGEQPRKPRLLGHSLRYMLELYRRSADSHGHPRENRTIGATMVRLVKPLTNVARPHRGTWHIQILGFPLRPNRGLYQLVRATVVYRHHLQLTRFNLSCHVEPWVQKNPTNHFPSSEGDSSKPSLMSNAWKEMDITQLVQQRFWNNKGHRILRLRFMCQQQKDSGGLELWHGTSSLDIAFLLLYFNDTHKSIRKAKFLPRGMEEFMERESLLRRTRQADGISAEVTASSSKHSGPENNQCSLHPFQISFRQLGWDHWIIAPPFYTPNYCKGTCLRVLRDGLNSPNHAIIQNLINQLVDQSVPRPSCVPYKYVPISVLMIEANGSILYKEYEGMIAESCTCR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0684-Ab Anti-BMP15/ GDF9B/ ODG2 functional antibody
    Target Antigen GM-Tg-g-SE0684-Ag BMP15 protein
    ORF Viral Vector pGMLP002908 Human BMP15 Lentivirus plasmid
    ORF Viral Vector vGMLP002908 Human BMP15 Lentivirus particle


    Target information

    Target ID GM-SE0684
    Target Name BMP15
    Gene ID 9210, 12155, 695457, 59302, 100306941, 100856301, 353351, 100052461
    Gene Symbol and Synonyms Bmp-15,BMP15,GDF-9B,GDF9B,ODG2,POF4
    Uniprot Accession O95972
    Uniprot Entry Name BMP15_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000130385
    Target Classification Not Available

    This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate subunits of a disulfide-linked homodimer, or alternatively, a heterodimer, with the related protein, growth differentiation factor 9 (GDF9). This protein plays a role in oocyte maturation and follicular development, through activation of granulosa cells. Defects in this gene are the cause of ovarian dysgenesis and are associated with premature ovarian failure. [provided by RefSeq, Aug 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.