Human PPOX/PPO/ V290M ORF/cDNA clone-Lentivirus plasmid (NM_000309)

Pre-made Human PPOX/PPO/ V290M Lentiviral expression plasmid for PPOX lentivirus packaging, PPOX lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to PPOX/PPO products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002974 Human PPOX Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002974
Gene Name PPOX
Accession Number NM_000309
Gene ID 5498
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1434 bp
Gene Alias PPO, V290M, VP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGCCGGACCGTGGTCGTGCTGGGCGGAGGCATCAGCGGCTTGGCCGCCAGTTACCACCTGAGCCGGGCCCCCTGCCCCCCTAAGGTGGTCCTAGTGGAGAGCAGTGAGCGTCTGGGAGGCTGGATTCGCTCCGTTCGAGGCCCTAATGGTGCTATCTTTGAGCTTGGACCTCGGGGAATTAGGCCAGCGGGAGCCCTAGGGGCCCGGACCTTGCTCCTGGTTTCTGAGCTTGGCTTGGATTCAGAAGTGCTGCCTGTCCGGGGAGACCACCCAGCTGCCCAGAACAGGTTCCTCTACGTGGGCGGTGCCCTGCATGCCCTACCCACTGGCCTCAGGGGGCTACTCCGCCCTTCACCCCCCTTCTCCAAACCTCTGTTTTGGGCTGGGCTGAGGGAGCTGACCAAGCCCCGGGGCAAAGAGCCTGATGAGACTGTGCACAGTTTTGCCCAGCGCCGCCTTGGACCTGAGGTGGCGTCTCTAGCCATGGACAGTCTCTGCCGTGGAGTGTTTGCAGGCAACAGCCGTGAGCTCAGCATCAGGTCCTGCTTTCCCAGTCTCTTCCAAGCTGAGCAAACCCATCGTTCCATATTACTGGGCCTGCTGCTGGGGGCAGGGCGGACCCCACAGCCAGACTCAGCACTCATTCGCCAGGCCTTGGCTGAGCGCTGGAGCCAGTGGTCACTTCGTGGAGGTCTAGAGATGTTGCCTCAGGCCCTTGAAACCCACCTGACTAGTAGGGGGGTCAGTGTTCTCAGAGGCCAGCCGGTCTGTGGGCTCAGCCTCCAGGCAGAAGGGCGCTGGAAGGTATCTCTAAGGGACAGCAGTCTGGAGGCTGACCACGTTATTAGTGCCATTCCAGCTTCAGTGCTCAGTGAGCTGCTCCCTGCTGAGGCTGCCCCTCTGGCTCGTGCCCTGAGTGCCATCACTGCAGTGTCTGTAGCTGTGGTGAATCTGCAGTACCAAGGAGCCCATCTGCCTGTCCAGGGATTTGGACATTTGGTGCCATCTTCAGAAGATCCAGGAGTCCTGGGAATCGTGTATGACTCAGTTGCTTTCCCTGAGCAGGACGGGAGCCCCCCTGGCCTCAGAGTGACTGTGATGCTGGGAGGTTCCTGGTTACAGACACTGGAGGCTAGTGGCTGTGTCTTATCTCAGGAGCTGTTTCAACAGCGGGCCCAGGAAGCAGCTGCTACACAATTAGGACTGAAGGAGATGCCGAGCCACTGCTTGGTCCATCTACACAAGAACTGCATTCCCCAGTATACACTAGGTCACTGGCAAAAACTAGAGTCAGCTAGGCAATTCCTGACTGCTCACAGGTTGCCCCTGACTCTGGCTGGAGCCTCCTATGAGGGAGTTGCTGTTAATGACTGTATAGAGAGTGGGCGCCAGGCAGCAGTCAGTGTCCTGGGCACAGAACCTAACAGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T34239-Ab Anti-PPOX monoclonal antibody
    Target Antigen GM-Tg-g-T34239-Ag PPOX protein
    ORF Viral Vector pGMLP002974 Human PPOX Lentivirus plasmid
    ORF Viral Vector vGMLP002974 Human PPOX Lentivirus particle


    Target information

    Target ID GM-T34239
    Target Name PPOX
    Gene ID 5498, 19044, 719910, 289219, 101090326, 478980, 515770, 100066168
    Gene Symbol and Synonyms PPO,PPOX,V290M,VP
    Uniprot Accession P50336
    Uniprot Entry Name PPOX_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000143224
    Target Classification Not Available

    This gene encodes the penultimate enzyme of heme biosynthesis, which catalyzes the 6-electron oxidation of protoporphyrinogen IX to form protoporphyrin IX. Mutations in this gene cause variegate porphyria, an autosomal dominant disorder of heme metabolism resulting from a deficiency in protoporphyrinogen oxidase, an enzyme located on the inner mitochondrial membrane. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.