Human TMED7/CGI-109/p24g3 ORF/cDNA clone-Lentivirus plasmid (NM_181836)

Cat. No.: pGMLP003031
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TMED7/CGI-109/p24g3 Lentiviral expression plasmid for TMED7 lentivirus packaging, TMED7 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to TMED7/CGI-109 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $468.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003031
Gene Name TMED7
Accession Number NM_181836
Gene ID 51014
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 675 bp
Gene Alias CGI-109,p24g3,p24gamma3,p27
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCCGCGGCCGGGGTCCGCGCAGCGCTGGGCGGCCGTCGCGGGCCGTTGGGGGTGCAGGCTGCTCGCACTGCTGCTACTGGTGCCTGGACCCGGCGGCGCCTCTGAGATCACCTTCGAGCTTCCTGACAACGCCAAGCAGTGCTTCTACGAGGACATCGCTCAGGGCACCAAGTGCACCCTGGAGTTCCAGGTGATTACTGGTGGTCACTATGATGTAGATTGTCGATTAGAAGATCCTGATGGTAAAGTGTTATACAAAGAGATGAAGAAACAGTATGATAGTTTTACCTTCACAGCCTCCAAAAATGGGACATACAAATTTTGCTTCAGCAATGAATTTTCTACTTTCACACATAAAACTGTATATTTTGATTTTCAAGTTGGAGAAGACCCACCTTTGTTTCCTAGTGAGAACCGAGTCAGTGCTCTTACCCAGATGGAATCTGCCTGTGTTTCAATTCACGAAGCTCTGAAGTCTGTCATCGATTATCAGACTCATTTCCGTTTAAGAGAAGCTCAAGGCCGAAGCCGAGCAGAGGATCTAAATACAAGAGTGGCCTATTGGTCAGTAGGAGAAGCCCTCATTCTTCTGGTGGTTAGCATAGGGCAGGTATTTCTTTTGAAAAGCTTTTTCTCAGATAAAAGAACCACCACAACTCGTGTTGGATCATAA
ORF Protein Sequence MPRPGSAQRWAAVAGRWGCRLLALLLLVPGPGGASEITFELPDNAKQCFYEDIAQGTKCTLEFQVITGGHYDVDCRLEDPDGKVLYKEMKKQYDSFTFTASKNGTYKFCFSNEFSTFTHKTVYFDFQVGEDPPLFPSENRVSALTQMESACVSIHEALKSVIDYQTHFRLREAQGRSRAEDLNTRVAYWSVGEALILLVVSIGQVFLLKSFFSDKRTTTTRVGS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1951-Ab Anti-TMED7 monoclonal antibody
    Target Antigen GM-Tg-g-IP1951-Ag TMED7 protein
    ORF Viral Vector pGMLP003031 Human TMED7 Lentivirus plasmid
    ORF Viral Vector vGMLP003031 Human TMED7 Lentivirus particle


    Target information

    Target ID GM-IP1951
    Target Name TMED7
    Gene ID 51014, 66676, 100533189, 252889, 101100690, 481436, 100125926, 100529263
    Gene Symbol and Synonyms 3930401E15Rik,5830493P14Rik,CGI-109,p24g3,p24gamma3,p27,Tag,TMED7,TRAM
    Uniprot Accession Q9Y3B3
    Uniprot Entry Name TMED7_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000134970
    Target Classification Not Available

    Predicted to be involved in Golgi organization; endoplasmic reticulum to Golgi vesicle-mediated transport; and intracellular protein transport. Located in Golgi apparatus; endoplasmic reticulum; and endoplasmic reticulum-Golgi intermediate compartment. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.