Human HDAC11/HD11 ORF/cDNA clone-Lentivirus plasmid (NM_024827)

Cat. No.: pGMLP003125
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human HDAC11/HD11 Lentiviral expression plasmid for HDAC11 lentivirus packaging, HDAC11 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to HDAC11/HD11 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $592.32
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003125
Gene Name HDAC11
Accession Number NM_024827
Gene ID 79885
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1044 bp
Gene Alias HD11
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTACACACAACCCAGCTGTACCAGCATGTGCCAGAGACACGCTGGCCAATCGTGTACTCGCCGCGCTACAACATCACCTTCATGGGCCTGGAGAAGCTGCATCCCTTTGATGCCGGAAAATGGGGCAAAGTGATCAATTTCCTAAAAGAAGAGAAGCTTCTGTCTGACAGCATGCTGGTGGAGGCGCGGGAGGCCTCGGAGGAGGACCTGCTGGTGGTGCACACGAGGCGCTATCTTAATGAGCTCAAGTGGTCCTTTGCTGTTGCTACCATCACAGAAATCCCCCCCGTTATCTTCCTCCCCAACTTCCTTGTGCAGAGGAAGGTGCTGAGGCCCCTTCGGACCCAGACAGGAGGAACCATAATGGCGGGGAAGCTGGCTGTGGAGCGAGGCTGGGCCATCAACGTGGGGGGTGGCTTCCACCACTGCTCCAGCGACCGTGGCGGGGGCTTCTGTGCCTATGCGGACATCACGCTCGCCATCAAGTTTCTGTTTGAGCGTGTGGAGGGCATCTCCAGGGCTACCATCATTGATCTTGATGCCCATCAGGGCAATGGGCATGAGCGAGACTTCATGGACGACAAGCGTGTGTACATCATGGATGTCTACAACCGCCACATCTACCCAGGGGACCGCTTTGCCAAGCAGGCCATCAGGCGGAAGGTGGAGCTGGAGTGGGGCACAGAGGATGATGAGTACCTGGATAAGGTGGAGAGGAACATCAAGAAATCCCTCCAGGAGCACCTGCCCGACGTGGTGGTATACAATGCAGGCACCGACATCCTCGAGGGGGACCGCCTTGGGGGGCTGTCCATCAGCCCAGCGGGCATCGTGAAGCGGGATGAGCTGGTGTTCCGGATGGTCCGTGGCCGCCGGGTGCCCATCCTTATGGTGACCTCAGGCGGGTACCAGAAGCGCACAGCCCGCATCATTGCTGACTCCATACTTAATCTGTTTGGCCTGGGGCTCATTGGGCCTGAGTCACCCAGCGTCTCCGCACAGAACTCAGACACACCGCTGCTTCCCCCTGCAGTGCCCTGA
ORF Protein Sequence MLHTTQLYQHVPETRWPIVYSPRYNITFMGLEKLHPFDAGKWGKVINFLKEEKLLSDSMLVEAREASEEDLLVVHTRRYLNELKWSFAVATITEIPPVIFLPNFLVQRKVLRPLRTQTGGTIMAGKLAVERGWAINVGGGFHHCSSDRGGGFCAYADITLAIKFLFERVEGISRATIIDLDAHQGNGHERDFMDDKRVYIMDVYNRHIYPGDRFAKQAIRRKVELEWGTEDDEYLDKVERNIKKSLQEHLPDVVVYNAGTDILEGDRLGGLSISPAGIVKRDELVFRMVRGRRVPILMVTSGGYQKRTARIIADSILNLFGLGLIGPESPSVSAQNSDTPLLPPAVP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T97903-Ab Anti-HDAC11 monoclonal antibody
    Target Antigen GM-Tg-g-T97903-Ag HDAC11 protein
    ORF Viral Vector pGMLP003125 Human HDAC11 Lentivirus plasmid
    ORF Viral Vector vGMLP003125 Human HDAC11 Lentivirus particle


    Target information

    Target ID GM-T97903
    Target Name HDAC11
    Gene ID 79885, 232232, 693537, 297453, 101081876, 484633, 519899, 100055240
    Gene Symbol and Synonyms HD11,HDAC11
    Uniprot Accession Q96DB2
    Uniprot Entry Name HDA11_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000163517
    Target Classification Not Available

    This gene encodes a class IV histone deacetylase. The encoded protein is localized to the nucleus and may be involved in regulating the expression of interleukin 10. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Apr 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.