Human SLC16A4/MCT4/ MCT5 ORF/cDNA clone-Lentivirus plasmid (NM_004696)

Pre-made Human SLC16A4/MCT4/ MCT5 Lentiviral expression plasmid for SLC16A4 lentivirus packaging, SLC16A4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to SLC16A4/MCT4 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP003146 Human SLC16A4 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP003146
Gene Name SLC16A4
Accession Number NM_004696
Gene ID 9122
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1464 bp
Gene Alias MCT4, MCT5
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCTGAAGAGGGAGGGGAAGGTCCAACCTTACACTAAAACCCTGGATGGAGGATGGGGATGGATGATTGTGATTCATTTTTTCCTGGTGAATGTGTTTGTGATGGGGATGACCAAGACTTTTGCAATTTTCTTTGTGGTCTTTCAAGAAGAGTTTGAAGGCACCTCAGAGCAAATTGGTTGGATTGGATCCATCATGTCATCTCTTCGTTTTTGTGCAGGTCCCCTGGTTGCTATTATTTGTGACATACTTGGAGAGAAAACTACCTCCATTCTTGGGGCTTTCGTTGTTACTGGTGGATATCTGATCAGCAGCTGGGCCACAAGTATTCCTTTTCTTTGTGTGACTATGGGACTTCTACCCGGTTTGGGTTCTGCTTTCTTATACCAAGTGGCTGCTGTGGTAACTACCAAATACTTCAAAAAACGATTGGCTCTTTCTACAGCTATTGCCCGTTCTGGGATGGGACTGACTTTTCTTTTGGCACCCTTTACAAAATTCCTGATAGATCTGTATGACTGGACAGGAGCCCTTATATTATTTGGAGCTATCGCATTGAATTTGGTGCCTTCTAGTATGCTCTTAAGACCCATCCATATCAAAAGTGAGAACAATTCTGGTATTAAAGATAAAGGCAGCAGTTTGTCTGCACATGGTCCAGAGGCACATGCAACAGAAACACACTGCCATGAGACAGAAGAGTCTACCATCAAGGACAGTACTACGCAGAAGGCTGGACTACCTAGCAAAAATTTAACAGTCTCACAAAATCAAAGTGAAGAGTTCTACAATGGGCCTAACAGGAACAGACTGTTATTAAAGAGTGATGAAGAAAGTGATAAGGTTATTTCGTGGAGCTGCAAACAACTGTTTGACATTTCTCTCTTTAGAAATCCTTTCTTCTACATATTTACTTGGTCTTTTCTCCTCAGTCAGTTAGCATACTTCATCCCTACCTTTCACCTGGTAGCCAGAGCCAAAACACTGGGGATTGACATCATGGATGCCTCTTACCTTGTTTCTGTAGCAGGTATCCTTGAGACGGTCAGTCAGATTATTTCTGGATGGGTTGCTGATCAAAACTGGATTAAGAAGTATCATTACCACAAGTCTTACCTCATCCTCTGCGGCATCACTAACCTGCTTGCTCCTTTAGCCACCACATTTCCACTACTTATGACCTACACCATCTGCTTTGCCATCTTTGCTGGTGGTTACCTGGCATTGATACTGCCTGTACTGGTTGATCTGTGTAGGAATTCTACAGTAAACAGGTTTTTGGGACTTGCCAGTTTCTTTGCTGGGATGGCTGTCCTTTCTGGACCACCTATAGCAGGCTGGTTATATGATTATACCCAGACATACAATGGCTCTTTCTACTTCTCTGGCATATGCTATCTCCTCTCTTCAGTTTCCTTTTTTTTTGTACCATTGGCCGAAAGATGGAAAAACAGTCTGACCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1649-Ab Anti-SLC16A4 monoclonal antibody
    Target Antigen GM-Tg-g-IP1649-Ag SLC16A4 protein
    ORF Viral Vector pGMLV000234 Human SLC16A4 Lentivirus plasmid
    ORF Viral Vector pGMLP000587 Human SLC16A4 Lentivirus plasmid
    ORF Viral Vector pGMLP003146 Human SLC16A4 Lentivirus plasmid
    ORF Viral Vector vGMLV000234 Human SLC16A4 Lentivirus particle
    ORF Viral Vector vGMLP000587 Human SLC16A4 Lentivirus particle
    ORF Viral Vector vGMLP003146 Human SLC16A4 Lentivirus particle


    Target information

    Target ID GM-IP1649
    Target Name SLC16A4
    Gene ID 9122, 229699, 701535, 295356, 101082585, 479908, 525480, 100058580
    Gene Symbol and Synonyms MCT 5,MCT4,MCT5,SLC16A4
    Uniprot Accession O15374
    Uniprot Entry Name MOT5_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000168679
    Target Classification Not Available

    Predicted to enable monocarboxylic acid transmembrane transporter activity. Predicted to be involved in monocarboxylic acid transport. Predicted to be located in membrane. Predicted to be integral component of plasma membrane. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.